Background

Shoot branching determines the aboveground architecture of a plant and lateral branches generally arise from the outgrowth of axillary buds, which is controlled by a complex interaction of phytohormones and environmental conditions [1]. The perennial tea plant (Camellia sinensis) is an economically important woody crop, with their bud leaves from lateral branches collected for tea and food production [2, 3]. In virture of such economic value, understanding the molecular regulatory mechanism of shoot branching in tea plant is essential [1].

Cytokinins (CTKs) are primary hormones constituting the various endogenous CTKs in plants [7A).

The temperature gradient amplification of different 5′ UTR AS was carried out. The primer pairs 5AS1F + 5ASR, 5AS2F + 5ASR and 5AS3F + 5ASR were used to amplify 5AS1, 5AS2 and 5AS3, respectively. Lines A1 ~ A6, B1 ~ B6 and C1 ~ C6 correspond to the amplified results of primer pairs 5AS1F + 5ASR (247 bp), 5AS2F + 5ASR (247 bp) and 5AS3F + 5ASR (249 bp) under different temperature, respectively. The primer pairs 5AS1F + 5ASR and 5AS2F + 5ASR both could amplify the objective band, respectively. Moreover, the primer pairs both have higher amplification efficiency under 54 °C and 55 °C compared with other temperature (Figure S7B).

The expression of CsA-IPT5 transcripts in the different tissues of tea plant

The expression patterns of CsA-IPT5 transcripts in the different tissues of tea plant were detected. The results showed that the CsA-IPT5 transcripts expressed in all the tested tissues. The total CsA-IPT5 transcripts in the stem node and root were the highest, followed by that in the young leaf and axillary bud. In the stem node, the 5AS3 expression/total expression (5AS3 ratio) and 3AS2 expression/total expression (3AS2 ratio) was significantly higher than the other three splice variants; in the young leaf, the 3AS1 ratio and 3AS2 ratio both were significantly higher than the other three splice variants; in the axillary bud, except for 5AS2, the other four splice variants all have relatively high expression levels, and the 5AS3 ratio was the highest among them; in the flower, all five splice variants have a relatively high expression level, and the 5AS1 ratio and 5AS2 ratio was relatively low compared with the three other splice variants; in the root, 5AS3, 3AS1 and 3AS2 have relatively high expression levels compared with the three other splice variants (Fig. 2G, H). Together, among the five splice variants, 5AS3 had the highest ratio in the stem node and axillary buds, while 3AS2 showed the highest ratio in young leaf and flower, and 3AS1 appeared to be the highest in roots. Furthermore, among the five splice variants of CsA-IPT5, 3AS2 all had relatively high ratio in the five tested tissues.

Involvement of CsA-IPT5 transcripts in the shoot branching induced by exogenous 6-BA

In the internode, 6-BA induced the expression of total CsA-IPT5 transcripts, 5AS1, 5AS2, 3AS1, and 3AS2 compared with the relevant controls. Specially, in the internode, the total CsA-IPT5 transcripts induced by 6-BA were both significantly higher at 24 h and 6 d compared with the control. The 5AS1, 5AS2 and 3AS1 ratio induced by 6-BA was all significantly higher than that in the relative control at 12 h and 24 h. The 3AS2 ratio induced by 6-BA was significantly higher than that in the control at 6 d and 9 d. However, 6-BA did not increase the 5AS3 ratio compared with the control (Fig. 3; Table S4).

Fig. 3
figure 3

Expression of CsA-IPT5 transcripts and CsA-IPT5 protein in the internode induced by 6-BA application. A Expression of total CsA-IPT5 transcripts in the internode at different time points induced by 6-BA. B-F The ratios of CsA-IPT5 splice variants in the internode at different time points induced by 6-BA. Western blot (G) and ‘CsA-IPT5/Actin’ (H) which showed CsA-IPT5 protein expression in the internode at 3 d, 6 d, 9 d and 18 d after 6-BA treatment. Data are means ±SD (n = 3 or 6). For figures A-F, asterisks indicate significant differences in each index between control and 6-BA treatment at each time point; for figure H, asterisks indicate significant differences in A-IPT/Actin between control and 6-BA treatment at each time point (**P < 0.01; Student’s t-test)

Full size image

In the stem node, the total CsA-IPT5 transcripts both showed a trend of first increasing and then decreasing in the control and 6-BA treatment, respectively, and 6-BA did not increase the expression of total CsA-IPT5 transcripts compared with the control (Fig. 4A). In the root, the expression of the total CsA-IPT5 transcripts in the 6-BA treatment was all significantly higher than that in the control at all the test time points (Fig. 4D). The iPR content both increased in the internode and stem node when treated with 6-BA (Fig. 4B, C). The protein expression of CsA-IPT5 in the internode was induced by 6-BA at 6 d and 9 d compared with the control (Fig. 3G, H), however, it did not induce the increase of CsA-IPT5 protein expression in the stem node (Fig. 4E, F).

Fig. 4
figure 4

Expression of total CsA-IPT5 transcripts in the stem node and root, CTKs contents in the internode and stem node, and expression of CsA-IPT5 protein in the stem node induced by 6-BA application. A,D Expression of total CsA-IPT5 transcripts in the stem node (A) and root (D) at different time points induced by 6-BA. B, C CTK contents in the internode (B) and stem node (C) induced by 6-BA. Western blot (E) and ‘CsA-IPT5/Actin’ (F) which showed CsA-IPT5 protein expression in the stem node at 9 d and 18 d after 6-BA treatment. Data are means ±SD (n = 3 or 6). For figures A and D, asterisks indicate significant differences in the expression of total CsA-IPT5 transcripts between control and 6-BA treatment at each time point; for figures B and C, asterisks indicate significant differences in each index between control and 6-BA treatment; for figure F, asterisks indicate significant differences in ‘CsA-IPT5/Actin’ between control and 6-BA treatment at each time point (**P < 0.01; Student’s t-test)

Full size image

Involvement of CsA-IPT5 transcripts in regulating axillary bud development induced by pruning

The morphology and size of the axillary buds at 16 d after pruning are shown in Fig. 5A. Compared with the control, pruning induced the accumulation of tZ, tZ riboside (tZR) and iP riboside (iPR) in the internodes, tZ and tZR in the stem node, as well as tZ in the axillary buds, respectively, at 8 d after pruning (Fig. 5B-E). In the axillary bud, there was no change in the overall transcripts of CsA-IPT5 either in the control or in the pruning groups, and pruning did not induce the CsA-IPT5 protein expression in the axillary buds compared with the control (Fig. 5F-H).

Fig. 5
figure 5

The axillary bud growth vigor, CTK contents in the three tissues, and the expression of the total CsA-IPT5 transcripts and CsA-IPT5 protein in the axillary bud of the first node below the cuttings induced by the second pruning. A The growth vigor of the axillary bud at 16 d after pruning. B-E Contents of tZ- and iP-type CTKs in the different tissues at 8 d after pruning. Data are means ±SD (n = 3). For each figure, letters indicate significant differences in the CTK concentration between control and pruning in each tissue (P < 0.05, Duncan’s multiple range test). F Expression of the total CsA-IPT5 transcripts in the axillary bud at different time points after pruning. G, H Western blot (G) and ‘CsA-IPT5/Actin’ (H) which showed the CsA-IPT5 protein expression levels in the axillary bud at different time points after pruning. Data are means ±SD (n = 3). Letters indicate significant differences of CsA-IPT5/Actin between control and pruning at each time point (P < 0.05, Duncan’s multiple range test)

Full size image

In the stem node, the total CsA-IPT5 transcripts in the control and pruning groups both increased at first and then decreased from 0 h to 8 d, and that in the the pruning groups were significantly higher than that in the control at 24 h and 48 h (Fig. 6A). The 5AS3 ratio in control showed a trend of gradual decreasing, whereas it showed a trend of first decreasing and then increasing after pruning in the stem node (Fig. 6D). The 3AS2 ratio in control of the stem node showed a trend of first increasing and then decreasing, whereas it showed a trend of gradual increasing in the pruning treatment (Fig. 6F). Thus, compared with the relevant control, the pruning treatment induced the expression of 5AS3 and 3AS2 respectively, in the stem node. The ratios of 5AS1, 5AS2 and 3AS1 all did not increase both in the control and pruning treatment over time (Fig. 6B, C, E). Furthermore, compared with the control, pruning induced the protein expression of CsA-IPT5 in the stem node at 8 d after pruning (Fig. 6G, H). Compared with the control, the expression of total CsA-IPT5 transcripts was induced by pruning in the roots but not in the internode at all the tested time points (Fig. 6I).

Fig. 6
figure 6

Expression of CsA-IPT5 transcripts and CsA-IPT5 protein in the stem node, the expression of total CsA-IPT5 transcripts in the internode of the first node below the cuttings and root at different time points after the second pruning. A-H The expression of total CsA-IPT5 transcripts (A), CsA-IPT5 splice variants (B-F), and CsA-IPT5 protein (G, H) in the stem node after the pruning. I The expression of total CsA-IPT5 transcripts in the root and internode at different time points after pruning. Data are means ±SD (n = 6 or 3). For each figure, asterisks indicate significant differences in each index between control and pruning at each time point (**P < 0.01; Student’s t-test). Except for figure H, letters indicate significant differences of gene expression for each treatment among different time points (P < 0.05, Duncan’s multiple range test) (A-F). For figure H, letters indicate significant differences of CsA-IPT5/Actin between control and pruning at each time point (P < 0.05, Duncan’s multiple range test)

Full size image

Discussion

Abundance of leaf buds during shoot branching is indespensible for achieving high yield and quality of tea plant, thus artificially regulating the development of the lateral branches is necessary for tea production as its obvious apical dominance [2]. A-IPTs play essential roles in the synthesis of iP- and tZ-type CTKs [9, 26]. Up to now, the function of plant A-IPTs has been much studied, whereas little has been done to characterize the splice variants of plant A-IPT transcripts. In the present study, clones of alternatively spliced CsA-IPT5 mRNAs of tea plant with different 3ˊ UTR and 5ˊ UTR were identified.

Some sequences in the UTRs, such as AU-rich elements (ARE), could modulate mRNA stability and thus regulate the transcript accumulation and translation efficiency of the mRNA [19, 27]. Most of the reported sequences involved in mRNA stabilization reside within the 3′ UTR [28], meanwhile, Chen et al. [29] reported that the ATTTA-containing core domain in the 5′ UTR of human cytokine mRNA functions as a potent destabilizing element. The 5′ UTR can also be involved in modulating mRNA stability during the development and stress response of green plants [30,31,32,33]. In this study, there are one to four ATTTA motif(s) in the five 5′ UTR and 3′ UTR splice variants which were investigated for their regulatory effects.

In the current study, the biggest difference among the splice variants is in the repeats of the unstable ATTTA motifs. Our transient expression and mutation test showed differences in the repeats of the ATTTA motifs, varying from zero to four, in the fused GFP. The resuts showed that except for two mutants of 5AS2 (i.e., 5AS2 M4-1&2 and 5AS2 M4-1&2&3), there were all negative correlations between the transcriptional levels and the number of ATTTA motifs among the CsA-IPT5 splice variant and its relevant mutants. Furthermore, except for 5AS1 and 5AS1 M4-1&2, as well as 5AS2 M4-1&2 and 5AS2 M4-1&2&3, there were all negative correlations between the CsA-IPT5 protein expression and the number of ATTTA motifs among the AS variant and its relevant mutants. This seemed to be consistent with a number of previous studies which consider that transcripts containing a larger amount of ATTTA motifs and other ARE are more rapidly degraded than those containing a smaller amount of these motifs [17, 34]. In addition, this study showed that there were both no significant differences about the protein expression and transcriptional levels of fused GFP between that in the 5AS2 M4-1&2 and 5AS2 M4-1&2&3, which have two and one ATTTA motif(s) respectively, and this is consistent with an existing report that the accumulate rates of two alternative spliced mRNAs, which with one and two ATTTA motif(s) respectively, were not distinct in vitro [24].

The poly(A) consensus signal sequence, including the AATAA(A) motif and the less frequently found ATTAAA motif, located in the 3ˊ UTR of the mature mRNA, is essential for poly(A) tail formation during mRNA maturation [35, 36]. He et al. [24] reported that the ATTAAA sequence and AATAA sequence in the 3ˊ UTR both upregulated plant gene expression. Here, there are two ATTTA motifs and two ATTAA(A) motifs in the 3AS2, and there is one ATTTA motif and no poly(A) signal sequence in the 5AS3. Thus, compared with 5AS3, the significantly greater fluorescence and mRNA levels of 3AS2 may be attributed to the upregulated gene expression confered by the two AATAA(A) motifs. Likewise, compared with 3AS1, the higher expression levels of 3AS2 may be also attributed to the one more AATAA(A) motif in the 3AS2. Therefore, it is likely that the poly(A) signal sequence might be responsible for the higher transient expression levels of CsA-IPT5 splice variants, and the final transient expression level of CsA-IPT5 transcripts may be the result of the interplay of the two regulatory mechanisms that can act in opposing directions.

Studies in multiple plants have indicated that each organ or tissue has its own specific AS transcripts, and tissue specific AS may have potential functions [37]. This study showed that the CsA-IPT5 splice variants are expressed in all the tested tissues, including the stem node, young leaf, axillary bud, flower, and root, and their spatial expression patterns revealed a tissue preference and differences in expression levels. Furthermore, among the five splice variants of CsA-IPT5, 3AS2 all had relatively high ratio in the five tested tissues.

Shoot branching of plants includes two stages, the formation and the subsequent elongation growth and development of axillary buds. 6-BA is a kind of synthetic cytokinin inside the plant. Our previous studies showed that 6-BA application increased the number of lateral buds 1 month after treatment, thus promoted productive lateral branch formation of tea plant [38]. The current study showed strong correlations among the increased expression of total CsA-IPT5 transcripts, 5AS1, 5AS2, 3AS1, 3AS2, increased protein expression of CsA-IPT5, and increased iPR concentrations in the internode induced by 6-BA. Nevertheless, the results indicated 6-BA did not induce the expression of CsA-IPT5 transcripts and CsA-IPT5 protein in the stem node compared with the control. Thus, 6-BA may induce iPR biosynthesis in the internode, meanwhile, the increased iPR concentration detected in the internode might also be transported from root, as 6-BA increased the expression of total CsA-IPT5 in the root compared with the control. Thus, the increased iPR concentration detected in the stem node might be transported from the internode and root. Together, it can be speculated that after 6-BA treatment, the iPR biosynthsized in the internode and root was transported to the axillary bud and promote its development (Fig. 7a). Furthermore, the 5AS1, 5AS2, 3AS1 and 3AS2 all played key roles in the shoot branching induced by 6-BA.

Fig. 7
figure 7

Proposed models of CsA-IPT5 transcripts in the regulation of shoot branching in tea plant. A A proposed model of CsA-IPT5 transcripts in the regulation of shoot branching induced by exogenous 6-BA application in tea plant. B A proposed model of CsA-IPT5 transcripts in the regulation of shoot branching induced by the second pruning in tea plant. Each shoot branching process regulated by CsA-IPT5 transcripts are included in a single rectangle composed by brown dashed lines, respectively. Black dashed arrows represent exogenous 6-BA spraying. Black dashed lines represent the second pruning. Light blue ellipses represent the transported CTKs. Blue rectangles represent locally biosynthetic CTKs. Black arrows represent activation. Light blue solid arrows represent transportation, whereas light blue dashed arrows represent long-distance transportation.

Full size image

Pruning is an essential agronomic practice in tea cultivation [39, 40]. In this study, the increased expression of total CsA-IPT5 transcripts, 5AS3 and 3AS2, increased protein expression of CsA-IPT5, as well as increased concentrations of tZ and tZR in the stem node induced by pruning treatment were shown to be positively correlated. Thus the increased concentrations of tZ and tZR detected in the stem node at least partly biosynthsized by itself. Furthermore, pruning induced the expression of total CsA-IPT5 transcripts in the root but not in the internode. Thus, it can be speculated that the increased concentrations of tZ, tZR and iPR in the internode tested here may come from root. However, as pruning did not induce the expression of total CsA-IPT5 transcripts and CsA-IPT5 protein in the axillary bud, it is possible that the increased tZ accumulation in the develo** axillary bud is transported from other tissues, including the stem node and root, and promoted the axillary bud developement (Fig. 7b). Furthermore, in the axillary bud development induced by pruning, the 5AS3 and 3AS2 both played key roles.

The regulatory effects of ATTTA motif and other ARE during different developmental stages or under environmental stimui have been frequently reported in higher eukaryotes. For example, optimal metabolic adaptation to oxygen variations relies on ARE-mediated mRNA stability and thus the regulation of gene transcription and enzyme activity in Drosophila cells [22]. The splice variants of high-glucose-regulated (HGRG-14) mRNA, which contains different numbers of ATTTA motifs, is produced and correlates well with HGRG-14 protein levels under different glucose conditions in human mesangial cells [19]. As discussed above, it is most likely that during shoot branching induced by 6-BA treatment or pruning, the expression patterns of the five UTR splice variants of CsA-IPT5 were differently regulated in this study. The splice variants regulate the synthesis of CsA-IPT5 protein as well as tZ- and iP- CTKs through changing the ratio of the five mRNAs. Furthermore, the 3AS2 might act as the most important transcript.

Conclusions

In summary, the present study examined the molecular mechanisms of shoot branching regulated by the AS transcripts of CsA-IPT5 in tea plant. The five CsA-IPT5 splice variants might play roles through compensation or competition with each other. Of the five, the 3AS2 of CsA-IPT5 may be the predominant transcript and act as a key determinant with specific functions in the dynamic equilibrium. This study highlights the underlying AS-based regulatory mechanisms in tea plant shoot branching, and it provides a material (gene) for improving the plant-type of woody plants.

Methods

Plant material and growth conditions

Adult tea plants (C. sinensis L.) of the widely grown cultivars in China, Long**g 43 (LJ43) and Zhongcha 108 (ZC108), were used in this study. All experiments were conducted in the tea garden of the Tea Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou, Zhejiang province, China. No permissions were necessary to collect such samples.

Isolation of the full-length cDNA of CsA-IPT

In the preliminary experiments, due to the lack of genomic data of tea plant cv. LJ43, we obtained the full-length cDNA of CsA-IPT in C. sinensis cv. LJ43 using RACE technology. The total RNA was extracted from the tea leaves of cv. LJ43 using the modified CTAB method. The first-strand cDNA for 5′ RACE and 3′ RACE of CsA-IPT was synthesized using Tiosbio SUPERSWITCH™ PCR cDNA synthetic kit (ST0091, Baoying Tonghui Biotechnology Co., Ltd., Bei**g, China), respectively. Purified PCR products were cloned into the pMD18-T vector (pEASY-T5 Zero Cloning Kit, TransGen Biotech, Bei**g, China), then transformed into the Trans1-T1 phage resistant chemically competent cell (TransGen Biotech). DNA sequencing was performed by TsingKe (Hangzhou, China). The verified forward primer of real-time quantitative PCR (qPCR) (CsIPT5-F query_L1) and the 3′ adaptor primers (3AP) provided in the RACE kit were used for the 3′ RACE-PCR at first, and then performed by nested PCR using the primers CsIPT5-3R2 and 3AP. The first amplification of the 5′ RACE was performed using the primers CsIPT5-5R1 and 5AP and then performed by nested PCR using the primers CsIPT5-5R2 and 5AP in the kit. The primers and the primer combinations used for RACE PCR are shown in Tables S1 and S2. The gradient program for RACE PCR was: 94 °C for 5 min, followed by 35 or 31 cycles of 94 °C for 30 s, 50-68 °C for 30 s, and 72 °C for 3.5 min, and then a 10 min final extension at 72 °C.

Bioinformatics analysis of the cloned CsA-IPT gene

The CsA-IPT5 cDNA sequence, deduced amino acid sequence, and open reading frame (ORF) were analyzed online or by the corresponding bioinformatics software. The deduced CsA-IPT5 and other known plant A-IPT genes were aligned with online CLUSTALW (http://www.ebi.ac.uk/Tools/msa/clustalw2).

Subcellular localization of CsA-IPT5

The primers for amplifying the CsA-IPT5 cDNA full-length ORF without the stop codon was designed (forward primer: 5′-CgACgACAAgACCgTcaccATGAGAATTTCATTCTCACCT-3′; reverse primer: 5′-GAGGAGAAGAGCCGTCGCCGAGTTGTGGCGGCGACA-3′), and the ORF sequence was fused to the green fluorescence protein (GFP, accession number U87973). The fusion gene was inserted into the plant binary expression vector pJP186 that contains the GFP, yielding the transformation vector 35S: A-IPT-GFP. This vector was used for the transient transformation of Nicotiana tabacum leaves. The epidermal cells of N. tabacum leaves were observed for subcellular localization of CsA-IPT5 using a confocal laser scanning microscope (Nikon A1, Japan). GFP fluorescence was excited at 488 nm and detected using a 492-548 nm emission filter. Chlorophyll autofluorescence was excited at 543 nm and detected using a 620-700 nm emission filter.

Transient expression of CsA-IPT5 splice variants specific GFP of 5′ and 3′ UTR in transfected N. benthamiana

Different repeats of ATTTA elements within the splice variants in 5′ and 3′ UTR of CsA-IPT5 were mutated to GCCCG by oligonucleotide-directed mutagenesis using the altered sites mutagenesis Kit (Promega, Madison, WI, USA) [27]. The splice variants and the mutated genes, as well as the corresponding sequences, are shown in Figure S5. For agroinfiltration, Nicotiana benthamiana plants were maintained in growth chambers at 20-25 °C throughout the assays. Agrobacterium tumefacient infiltration was performed as described by He et al. [24]. Bacterial cells were harvested and re-suspended in infiltration buffer to a final OD600 = 1.0. In co-infiltration experiments, equal volumes of each suspension were mixed before infiltration. GFP fluorescence was observed under a long-wavelength UV light (Black Ray model B 100A, Ultra-Violet Products Ltd., Cambridge, United Kingdom). The comparable constructs and the pCV1300:GFP control were infiltrated into a single leaf to reduce the background difference of the tobacco leaves.

Real-time quantitative PCR (qPCR)

Total RNA was isolated using an RNA extraction kit (Tiangen Biotech, Bei**g, China) and reverse transcribed using the PrimeScriptTM RT-PCR Kit (TaKaRa, Otsu, Japan), following the manufacturer’s instructions. The qPCR assay was performed on an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) using a SYBR Green PCR Master Mix (Takara, Shiga, Japan). The qPCR cycling conditions were as follows: 95 °C for 30 s and 40 cycles of 95 °C for 5 s. CsGAPDH was chosen as a stable reference gene for expression normalization. Relative gene expression of the CsAIPT5 transcripts was calculated by the 2-△CT method, and the expression ratio of each splice variant (i.e., expression of splice variant/total expression) was calculated. All qPCR detection of shoot branching experiments were carried out using six independent biological replicates.

The GFP transcript in transfected tobacco leaves were detected in qPCR using the GFP forward primer (TGTCAGTGGAGAGGGTGAA) and reverse primer (CGTCCTTGAAGAAGATGGTC). The PCR reaction was denatured at 95 °C for 1 min, followed by 45 cycles of 15 s at 95 °C, 20 s at 55 °C, and 20 s at 72 °C. The N. benthamiana Ubiquitin C gene (accession Number: AB026056.1) was chosen as the reference gene for qPCR analysis. Relative gene expression of the GFP was calculated by the 2-△△CT method.

Designing and verification of the qPCR primers for CsAIPT5 splice variants

Total RNA was extracted using the CTAB method, and genomic DNA was removed. RNA reverse transcription was carried out with HiScript II Q RT SuperMix for qPCR (+gDNA wiper) R223-01 (Vazyme, Nan**g, China). Thirteen primers were designed according to the 5ˊand 3ˊ UTRs of the CsA-IPT5 mRNA. The primers and the PCR amplification program can be seen in Table S3. The PCR program was: 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 59 °C for 30 s, and 72 °C for 30 s, and then a 10 min extension at 72 °C.

Production of the CsA-IPT5-specific polyclonal antibody and western blot analysis

Young adult New Zealand white rabbits were selected. The first antigen concentration was 1 mg/ml, 0.5 ml/ rabbit, two-free - four free antigen concentration in half, the same dose. The first immunization was made with complete adjuvant. The injections two to four were made with incomplete adjuvant. The collected serum was tested using ELISA. The purified antibodies were detected using ELISA and western blot, respectively. An anti-CsA-IPT5 peptide antibody was purified with antigen affinity purification (Hua An Bioscience Technology, Hangzhou, China).

Total protein of the N. benthamiana leaves and tea plant tissues was extracted using a plant protein extraction kit containing a protease inhibitor cocktail. The GFP protein level in N. benthamiana leaves was measured by Western Blotting. The first antibody GFP (Abcam, ab183734) and the goat anti-Rabbit IgG(H + L)secondary antibody (Thermo Pierce, 31,210) were used here. The synthetic GFP constructs were listed in Figure S5.

The total protein of tea plant tissues was quantified using the BCA protein assay kit. For western-blot analysis, the extracted proteins were separated by 10% SDS-PAGE and transferred to PVDF membranes. The primary antibody (anti-CsA-IPT5 peptide antibody) and secondary antibody were hybridized successively. The signal was detected using the SuperSignal® West Dura Extended Duration Substrate.

6-BA treatment and the pruning treatment

For shrub-type mature tea garden in which only spring tea was picked up, tea plants usually need pruning twice a year. For the first pruning, tea trees were heavily pruned after spring tea in late April, and all the branch leaves that are approximately 50 cm above the ground are pruned; the second pruning was carried out around July 20.

The 6-BA treatment of tea plant was described in our previous report [38]. Specifically, mature tea plants of cv. LJ43 that were heavily pruned in late April were used. Working solutions of 200 mg L− 1 6-benzyladine (6-BA) (J&K Scientific Ltd., Bei**g, China) were prepared, and 0.1% (v/v) Tween 20 was added before spraying. When the apical buds and two to three leaves below the bud grew out, the foliar portion of tea bushes was sprayed with 6-BA solutions. Control tea bushes were simultaneously sprayed with distilled H2O containing the same ratio of Tween 20.

For the second pruning experiment, the mature tea plants cv. ZC108 which were heavily pruned in late April were used. The second pruning was conducted at a height that was 20 cm higher than the last cut surface on July 25, 2019. Control tea bushes were not pruned. Three tissues of the first node below the cuttings, including the internode, stem node and axillary bud, were sampled at 0 h, 12 h, 24 h, 36 h, 48 h, 4 d, 8 d, and 16 d after pruning.

For the studies of 6-BA and pruning treatments, the samples both were collected from more than 10 trees as one biological replicate, frozen in liquid N2 immediately after sampling, and stored at − 80 °C until analysis.

Measurement of iP- and tZ-type CTK contents

The detection of iP- and tZ-type CTK contents was carried out using Agilent 1290 Infinity LC Ultra Performance Liquid Chromatography (UHPLC, Agilent) and 5500 QTRAP mass spectrograph (MS, AB SCIEX) (UHPLC-MS) (Shanghai Applied Protein Technology Co. Ltd., China).

Statistical analysis

Data were analyzed using Statistica (SAS Institute Inc., http://www.statsoft.com). Data were analyzed by one-way ANOVA; if the ANOVA analysis was significant (P < 0.05), Duncan’s multiple range test was used to detect the significant differences between/among groups. Differences between the control and treatment were determined by Student’s t-tests.