-
Article
Open AccessExploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation
G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the he...
-
Article
Open AccessCubic gauche polymeric nitrogen under ambient conditions
The long-sought cubic gauche phase of polymeric nitrogen (cg-PN) with nitrogen-nitrogen single bonds has been synthesized together with a related phase by a radio-frequency plasma reaction under near-ambient c...
-
Article
Open AccessQuantitative modeling of dose–response and drug combination based on pathway network
Quantitative description of dose–response of a drug for complex systems is essential for treatment of diseases and drug discovery. Given the growth of large-scale biological data obtained by multi-level assays...
-
Article
Open AccessImmunoproteomic profile of Trichinella spiralis adult worm proteins recognized by early infection sera
Trichinellosis, a widespread zoonosis, is regarded as an emerging or reemerging disease. Effective treatment and prognosis of trichinellosis depends on early diagnosis of the infection. The objective of this s...
-
Article
Semi-Preparative Scale Separation of Emodin from Plant Extract by Using Molecularly Imprinted Polymer as Stationary Phase
In this work, a core–shell molecularly imprinted polymer (MIP) was synthesized through sol–gel coating procedure by using silica beads, emodin, 3-aminopropyltriethoxysilane, tetraethoxysilane and tetrahydrofur...
-
Article
ESI Mass Spectrometric Exploration of Selective Recognition of G-Quadruplex in c-myb Oncogene Promoter Using a Novel Flexible Cyclic Polyamide
In this research, electrospray ionization mass spectrometry (ESI-MS) was used to probe the binding selectivity of a flexible cyclic polyamide (cβ) to G-quadruplexes from the long G-rich sequences in the c-myb onc...
-
Article
Open AccessCVDHD: a cardiovascular disease herbal database for drug discovery and network pharmacology
Cardiovascular disease (CVD) is the leading cause of death and associates with multiple risk factors. Herb medicines have been used to treat CVD long ago in china and several natural products or derivatives (e...
-
Article
Computational pharmacological studies on cardiovascular disease by Qishen Yiqi Diwan
Computational pharmacological methods were used to study the distribution of 1729 compounds contained in a Chinese medicine, Qishen Yiqi Diwan, in chemical space. The results show that most of these compounds ...
-
Chapter and Conference Paper
Experimental Diagnosis of Plasma Jets by Using X-Ray Laser
The supersonic jets and the interaction of strong shock waves are ubiquitous features of the nonlinear hydrodynamics of inertial-confinement fusion, astrophysics, and related fields of high energy-density scie...
-
Article
Investigation of formation, recognition, stabilization, and conversion of dimeric G-quadruplexes of HIV-1 integrase inhibitors by electrospray ionization mass spectrometry
The dimeric G-quadruplex structures of d(GGGTGGGTGGGTGGGT) (S1) and d(GTGGTGGGTGGGTGGGT) (S2), the potent nanomolar HIV-1 integrase inhibitors, were detected by electrospray ionization mass spectrometry (ESI-M...
-
Article
Evaluation of binding selectivity of a polyamide probe to single base-pair different dna in A·T-rich region by electrospray ionization mass spectrometry
In this study, electrospray ionization mass spectrometry (ESI-MS) was used for the evaluation of the binding selectivity of a polyamide probe to single-base pair different DNA in an A·T-rich region. In this pr...
-
Article
Investigation of noncovalent complexes between β-cyclodextrin and polyamide acids containing N-methylpyrrole and N-methylimidazole by electrospray ionization mass spectrometry
Electrospray ionization (ESI) mass spectrometry was utilized to investigate noncovalent complexes between β-cyclodextrin (β-CD) and five novel polyamide acids containing N-methylpyrrole and N-methylimidazole. The...
-
Article
Fluorescence dynamics of interactions between polyamide PyPyPyβDp and DNA
The photophysical properties of the polyamide PyPyPyβDp (PPP) were investigated by means of steady-state absorption and fluorescence spectroscopies, as well as time-resolved fluorescence spectroscopy. It was f...
-
Article
Synthesis of polyamides containingN-methylpyrrole andN-meth-ylimidazole and their anticancer activity
Three hairpin polyamides were designed and synthesized by a haloform reaction and DCC/ HOBt coupling reaction without amino protection and deprotection. Their anticancer activity were investigated with three k...
-
Article
Identification of the configuration of sex pheromones with a conjugated double bond by fuzzy similarity analysis of chemical shifts of olefinic carbons
A rapid analytical procedure for identifying the configuration of conjugated dienic sex pheromones and analogous compounds has been developed by fuzzy similarity analysis of 13C-NMR data, in which the chemical s...
-
Chapter
Tending to Saturated Gain of Soft X-Ray Laser at 23.2 and 23.6Nm
We proposed a design named “Four-Target Series Coupling” to work, on soft x-ray laser in Ne-like Ge plasma. The total length for four targets is up to 5.6cm. The gain length product (GL) for small signal is up...
