Dimeric Her2-specific affibody mediated cisplatin-loaded nanoparticles for tumor enhanced chemo-radiotherapy

Wang, Haijun; Jia, Dianlong; Yuan, Dandan; Yin, **aolei; Yuan, Fengjiao; Wang, Feifei; Shi, Wenna; Li, Hui; Zhu, Li-Min; Fan, Qing

doi:10.1186/s12951-021-00885-6

Dimeric Her2-specific affibody mediated cisplatin-loaded nanoparticles for tumor enhanced chemo-radiotherapy

Research
Open access
Published: 13 May 2021

Volume 19, article number 138, (2021)
Cite this article

Download PDF

You have full access to this open access article

Journal of Nanobiotechnology Aims and scope Submit manuscript

Dimeric Her2-specific affibody mediated cisplatin-loaded nanoparticles for tumor enhanced chemo-radiotherapy

Download PDF

Haijun Wang^1,4^na1,
Dianlong Jia³^na1,
Dandan Yuan⁵,
**aolei Yin⁴,
Fengjiao Yuan⁶,
Feifei Wang³,
Wenna Shi¹,
Hui Li¹,
Li-Min Zhu ORCID: orcid.org/0000-0003-1580-6851² &
…
Qing Fan¹

We’re sorry, something doesn't seem to be working properly.

Please try refreshing the page. If that doesn't work, please contact support so we can address the problem.

Abstract

Background

Solid tumor hypoxic conditions prevent the generation of reactive oxygen species (ROS) and the formation of DNA double-strand breaks (DSBs) induced by ionizing radiation, which ultimately contributes to radiotherapy (RT) resistance. Recently, there have been significant technical advances in nanomedicine to reduce hypoxia by facilitating in situ O₂ production, which in turn serves as a “radiosensitizer” to increase the sensitivity of tumor cells to ionizing radiation. However, off-target damage to the tumor-surrounding healthy tissue by high-energy radiation is often unavoidable, and tumor cells that are further away from the focal point of ionizing radiation may avoid damage. Therefore, there is an urgent need to develop an intelligent targeted nanoplatform to enable precise enhanced RT-induced DNA damage and combined therapy.

Results

Human epidermal growth factor receptor 2 (Her2)-specific dimeric affibody (Z_Her2) mediated cisplatin-loaded mesoporous polydopamine/MnO₂/polydopamine nanoparticles (Pt@mPDA/MnO₂/PDA-Z_Her2 NPs) for MRI and enhanced chemo-radiotherapy of Her2-positive ovarian tumors is reported. These NPs are biodegradable under a simulated tumor microenvironment, resulting in accelerated cisplatin release, as well as localized production of O₂. Z_Her2, produced using the E. coli expression system, endowed NPs with Her2-dependent binding ability in Her2-positive SKOV-3 cells. An in vivo MRI revealed obvious T₁ contrast enhancement at the tumor site. Moreover, these NPs achieved efficient tumor homing and penetration via the efficient internalization and penetrability of Z_Her2. These NPs exhibited excellent inhibition of tumor growth with X-ray irradiation. An immunofluorescence assay showed that these NPs significantly reduced the expression of HIF-1α and improved ROS levels, resulting in radiosensitization.

Conclusions

The nanocarriers described in the present study integrated Her2 targeting, diagnosis and RT sensitization into a single platform, thus providing a novel approach for translational tumor theranostics.

Graphic abstract

Fabrication, characterization, and biological evaluation of anti-HER2 indocyanine green-doxorubicin-encapsulated PEG-b-PLGA copolymeric nanoparticles for targeted photochemotherapy of breast cancer cells

Article Open access 21 April 2017

Optimizing cisplatin delivery to triple-negative breast cancer through novel EGFR aptamer-conjugated polymeric nanovectors

Article Open access 22 July 2021

Targeting triple‐negative breast cancer with an aptamer‐functionalized nanoformulation: a synergistic treatment that combines photodynamic and bioreductive therapies

Article Open access 29 March 2021

Background

Radiotherapy (RT), or the precise application of high energy ionizing radiation at the tumor site, can directly induce DNA breakages in tumor cells and/or indirectly damage tumor cells by generating reactive oxygen species (ROS) via water radiolysis and is an important tumor treatment strategy [1, 2]. More than 60% of malignant tumor patients receive RT at some stage during their illness, and 40% of the treatments are successful [3, 4]. However, the tumor microenvironment (TME) is complex and can contribute to the acquisition of RT resistance. Hypoxic conditions in the solid TME can be ascribed to an imbalance between the supply and consumption of O₂ in rapidly proliferating tumor cells, as well as dysfunctional tumor vasculature [5]. The hypoxic TME prevents ROS generation and formation of DNA double-strand breaks (DSBs), which are usually induced by ionizing radiation [2, 5], ultimately leading to RT resistance. Furthermore, tumor hypoxic conditions can bring about upregulation of hypoxia-inducible factor 1α (HIF-1α), which promotes endothelial cell survival following RT and thus further promotes RT resistance [6].

Traditional medical methods have made use of hyperbaric oxygen inhalation to alleviate hypoxic conditions and improve the tumor concentration of O₂, which acts a reservoir of radiation-induced ROS [6,7,8]. However, the dysfunctional tumor vascular system hinders the delivery of inhaled O₂ to the tumor, and the potential for oxygen poisoning, barometric injury, and decompression disease seriously limits the clinical utility of this method [9]. For decades, research has focused on the enhancement of RT efficacy by increasing radiation doses, but the severe side effects caused by excessive high-energy radiation to normal tissue and organs are unavoidable [5, Full size image

The affinity of the dimeric form affibody for its target is usually higher than that of the monomeric form [47]. So, the Z_Her2 affibody was dimerized upon the addition of a cysteine residue at the C-terminus. As expected, the molecular weight of Z_Her2 under natural conditions (Fig. 2b, in the absence of 2-ME) was approximately double than that of Z_Her2 under reductive conditions (Fig. 2b, in the presence of 2-ME), indicating that Z_Her2 forms disulfide bonds and dimers under natural conditions.

A slight increase in molecular weight was observed after Z_Her2 was labelled with the fluorescent agent 6-Carboxfluorescein (6-FAM) (Fig. 2c), with a labelling efficiency was approximately 100%. This label allowed for visual evaluation of the binding capacity between FAM-Z_Her2 and Her2-positive cells.

Finally, the Z_Her2 affibody was coupled with Pt@mPDA/MnO₂/PDA NPs via a Michael addition/Schiff base reaction by conjugating the amino group to the oxidized quinone form of the catechol groups under weak alkaline conditions. The mean hydrodynamic size of NPs increased slightly from 185 to 201 nm after Z_Her2 affibody conjugation (Additional file 1: Fig. S5a). Both NPs exhibited high colloidal stability and could be dispersed in PBS without aggregation over 24 h (Additional file 1: Fig. S5b). The elemental map** images (Fig. 2d–k) of mPDA/MnO₂/PDA-Z_Her2 NPs showed a homogeneous distribution of C, N, O, S, Mn, and Pt, further confirming the successful loading of cisplatin and coupling of Z_Her2. In addition, the Z_Her2 content was approximately 0.8 mg/g according to ICP-AES quantitation of the Z_Her2-specific S element.

Her2-positive cell-specific binding and cytotoxicity assay

Flow cytometry (FCM) and confocal laser scanning microscopy (CLSM) (Additional file 1: Fig. S6a–c) showed a concentration-dependent increase in fluorescence for a human ovarian cancer cell line (SKOV-3) after incubation with FITC-labelled anti-Her2 antibodies, while negligible FITC fluorescence was visible in a breast cancer cell line (MCF-7). This confirmed that SKOV-3 cells are Her2-positive, while MCF-7 cells are Her2-negative, which is consistent with previous results [48]. The binding activity of FAM-Z_Her2 with Her2-negative MCF-7 cells and Her2-positive SKOV-3 cells was examined by CLSM. As shown in Additional file 1: Fig. S7a, FAM-Z_Her2 specifically binds to SKOV-3 cells, while negligible FAM-Z_Her2 binding to MCF-7 cells was seen, indicating that these affibodies bind specifically to Her2-positive cancer cells. This Her2-specific binding activity was further confirmed by FCM, as strong FAM fluorescence was visible in SKOV-3 cells, while the binding was significantly reduced after pre-incubation with free Z_Her2 (Additional file 1: Fig. S7b).

FCM analysis was performed to evaluate the affinity of affibody monomers and dimers to Her2 receptors by measuring the FAM fluorescence intensity. As shown in Additional file 1: Fig. S8a, the binding rates of the dimeric Her2 affibody were 58.4%, compared to 33.8% for the monomer Her2 affibody at the same molar concentration. This confirms that the affinity of the dimeric Her2 affibody was higher than that of the monomeric Her2 affibody for Her2 receptors.

To determine whether Z_Her2 could enhance the internalization of NPs into Her2-overexpressing tumor cells, the uptake of Cy5.5-labelled mPDA/MnO₂/PDA (Cy5.5@mPDA/MnO₂/PDA) and mPDA/MnO₂/PDA-Z_Her2 (Cy5.5@mPDA/MnO₂/PDA-Z_Her2) NPs by SKOV-3 cells was measured using CLSM and quantified via a FCM assay. Minimal intracellular red fluorescence was observed in SKOV-3 cells after treatment with Cy5.5@mPDA/MnO₂/PDA NPs (Fig. 3a). In striking contrast, strong Cy5.5 (red) fluorescence was visible in SKOV-3 cells after incubation with Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs. A blocking experiment was carried out by pre-incubating SKOV-3 cells with free Z_Her2 (20 μg/mL) to further explore the mechanism of endocytosis. CLSM images showed an attenuated fluorescence signal inside pre-incubated SKOV-3 cells, indicating that the occupation of Her2 receptors resulted in reduced endocytosis and therefore failed to bind the NP-conjugated Z_Her2. Similarly, the FCM data showed that the uptake of cellular NPs significantly increased after conjugating Z_Her2 to Cy5.5@mPDA/MnO₂/PDA NPs; however, the cellular uptake was significantly reduced after pre-incubation of SKOV-3 cells with free Z_Her2 (Fig. 3b). Collectively, these results confirm that the Z_Her2 affibody can enhance the internalization of NPs into Her2-positive cancer cells due to the specific affinity between the Z_Her2 affibody and the Her2 receptor.

The cytocompatibility of drug-free mPDA/MnO₂/PDA-Z_Her2 NPs with human umbilical vein endothelial cells (HUVECs) was assessed using the MTT assay. As shown in Additional file 1: Fig. S8b, negligible toxicity to non-cancerous cells was observed, even when the concentration of mPDA/MnO₂/PDA-Z_Her2 NPs reached 250 μg/mL (> 90% viability), thus demonstrating the good cytocompatibility of the carrier materials.

All cisplatin-containing formulations exhibited dose-dependent cytotoxicity to SKOV-3 cells (Fig. 3c). The half maximal inhibitory concentrations (IC₅₀) of free cisplatin, Pt@mPDA/MnO₂/PDA NPs, and Pt@mPDA/MnO₂/PDA-Z_Her2 NPs for SKOV-3 cells were 9.79 ± 0.8 μg/mL, 3.18 ± 0.3 μg/mL, and 2.56 ± 0.1 μg/mL, respectively. In contrast to free cisplatin, the Pt@mPDA/MnO₂/PDA NPs exhibited more potent toxicity to cells over the entire cisplatin dose range (0.6–48 μg/mL), which can be ascribed to more efficient cellular uptake of NPs. More encouragingly, the conjugation of Z_Her2 to Pt@mPDA/MnO₂/PDA NPs further improved the cytotoxicity of the NPs because of more efficient internalization mediated by the targeted affinity for Z_Her2 on the NPs to Her2 receptors on SKOV-3 cells.

Calcein-AM/PI double staining was performed to evaluate the degree of apoptosis of the cells. The optimal degree of cell apoptosis was observed upon treatment with Pt@mPDA/MnO₂/PDA-Z_Her2 NPs (Fig. 3d), which is consistent with the MTT results.

Since O₂ is the ROS-generating resource induced by X-ray treatment, we next evaluated the effect of MnO₂-containing NPs on the intracellular oxidative stress levels. As shown in Fig. 3e, compared to X-ray treatment alone, treatment with MnO₂-free mPDA/PDA-Z_Her2 NPs combined with X-ray did not increase the intracellular ROS levels, as low DCF fluorescence was observed in cells receiving X-ray treatment with or without mPDA/PDA-Z_Her2 NPs. The intracellular oxidative stress levels of SKOV-3 cells improved after treatment with mPDA/MnO₂/PDA-Z_Her2 NPs alone, which can be ascribed to their ability of MnO₂ to produce HO• (one ROS species) [14, 15]. In stark contrast, cells receiving mPDA/MnO₂/PDA-Z_Her2 NPs and X-ray combined treatment largely increased the intracellular ROS levels compared with cells receiving MnO₂-free mPDA/PDA-Z_Her2 NPs + X-ray treatment. This finding indicates that treatment with MnO₂-containing NPs can facilitate ROS generation induced by ionizing radiation, confirming that these NPs have the capacity to increase radiosensitivity.

Hemolysis assay in vitro

A hemolysis assay was performed to determine the pharmacological safety of the NPs. No morphological changes and no significant lysis were observed after RBCs were incubated with Pt@mPDA/MnO₂/PDA NPs or Pt@mPDA/MnO₂/PDA-Z_Her2 NPs (Additional file 1: Fig. S9a, b). Both Pt@mPDA/MnO₂/PDA NPs and Pt@mPDA/MnO₂/PDA-Z_Her2 NPs had low hemolytic activity with only ~ 4.4% and ~ 4.7% RBC lysis, respectively (Additional file 1: Fig. S9c). The results indicate that both Pt@mPDA/MnO₂/PDA NPs and Pt@mPDA/MnO₂/PDA-Z_Her2 NPs are blood compatible biomaterials.

Tumor targeting profiles in vivo

Based on the in vitro results, Z_Her2-containing NPs were expected to target Her2-overexpressing tumor in vivo. The TME-activated MRI ability of NPs was first investigated in the SKOV-3 tumor-bearing mouse model. The T₁-weighted MRI signal in the tumors increased gradually over time, while negligible MRI signal enhancement was observed in the muscles (Fig. 4a and b). This can be attributed to the reduction of the MnO₂ layer to the MRI agent Mn²⁺ by the high levels of GSH in the TME [15, 49], which makes the MnO₂-containing NPs particularly attractive for tumor-specific imaging applications. Tumor accumulation of Pt@mPDA/MnO₂/PDA and Pt@mPDA/MnO₂/PDA-Z_Her2 NPs in SKOV-3 tumor-bearing mice at different times after intravenous injection was evaluated by tracking the MRI signal. The MRI signal was observed at the tumor site at 1 h post-injection of Pt@mPDA/MnO₂/PDA-Z_Her2 NPs, and the intensity increased gradually over time, indicating tumor-specific accumulation of these NPs (Fig. 4c). In contrast, decreased tumor accumulation of Pt@mPDA/MnO₂/PDA NPs was observed as the signal of the Pt@mPDA/MnO₂/PDA-Z_Her2 NPs was significantly stronger than that of Pt@mPDA/MnO₂/PDA NPs (p < 0.05) at 6 h (Fig. 4d). The biodistribution of free cisplatin, Pt@mPDA/MnO₂/PDA, and Pt@mPDA/MnO₂/PDA-Z_Her2 NPs in SKOV-3 tumors was determined by quantifying the Pt content using ICP-AES at 12 h post-injection (Additional file 1: Fig. S10). The Pt content in the tumors of mice treated with Pt@mPDA/MnO₂/PDA-Z_Her2 NPs was approximately 3.5-fold and two fold higher than that in mice treated with free cisplatin and Pt@mPDA/MnO₂/PDA NPs, respectively. The results reflect the more tumor retention of cisplatin-loaded NPs and tumor-targeting ability of the Z_Her2 affibody.

Immunofluorescence and bio-TEM assays were performed to further evaluate the tumor-targeting ability of Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs at the histological level. Immunofluorescence staining showed that Cy5.5 fluorescence (representing Cy5.5@mPDA/MnO₂/PDA NPs) was mainly restricted to the tumor peripheral tissue (Fig. 5a and c (I)), suggesting poor penetration of the NPs into the TME. It was very encouraging to see that in the presence of Z_Her2, the NPs overcame these biological barriers and penetrated deeply into the tumor tissue. As shown in Fig. 5b and c (II), strong red fluorescence was observed throughout the tumor, which co-localized with green fluorescence (representing Her2). These results confirm the efficient tumor homing and penetration of Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs, which is afforded by Z_Her2.

This effect was also confirmed by bio-TEM imaging (Fig. 6) of tumor tissue. Greater amounts of Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs were present within the cytoplasm, with little Cy5.5@mPDA/MnO₂/PDA NPs being observed in the tumor tissue. This superior tumor penetration and targeting capabilities are crucial for enhancing therapeutic efficacy. All these findings suggest that Z_Her2 modification combined with a TME-triggered off-to-on diagnostic agent make Pt@mPDA/MnO₂/PDA-Z_Her2 NPs particularly attractive for MRI-guided tumor-targeting treatment.

In vivo chemo-sensitized radiotherapy

Encouraged by the tumor-targeting and penetration effects of Z_Her2-functionalized NPs, the in vivo chemotherapeutic activities in SKOV-3 tumor-bearing mice were then assessed. In mice treated with PBS, the tumor volume increased steadily during the treatment period (Fig. 7a). Mice that were administered free cisplatin did not exhibit appreciable tumor suppression, probably due to insufficient accumulation of cisplatin in the tumors. In sharp contrast, mice that received Pt@mPDA/MnO₂/PDA NPs showed inhibited tumor progression as a result of the improved tumor retention of cisplatin-containing NPs. As expected, with the guidance of the Z_Her2 affibody, Pt@mPDA/MnO₂/PDA-Z_Her2 NPs achieved the most potent inhibition of tumor growth, and by the end of the treatment, these extracted tumors had the smallest volume and mass (Fig. 7b and c), persuasively demonstrating the excellent targeted antitumor activity of Pt@mPDA/MnO₂/PDA-Z_Her2 NPs. Body weight was monitored every day, and no obvious difference was observed among all the treated groups (Fig. 7d).

A TUNEL assay was conducted to determine the levels of apoptosis in the tumor tissue. The largest number of green-colored cells (indicating the highest levels of apoptosis) were observed in tumors taken from mice receiving Pt@mPDA/MnO₂/PDA-Z_Her2 NPs (Fig. 7e), indicating that these NPs had the most potent antitumor effects.

Based on the remarkable tumor inhibition effects of Pt@mPDA/MnO₂/PDA-Z_Her2 NPs, the combined chemo-radiation therapeutic efficacy with these NPs, especially the enhanced RT effect, by adopting MnO₂ as a radiosensitizer for hypoxic tumors was next assessed. The treatment schedule for chemo-radiotherapy is illustrated in Fig. 8a. RT alone did not have any significant antitumor effects, possibly because of RT resistance caused by the hypoxic TME and a sharp growth in tumor size (Fig. 8b–d) was observed during the treatment period. Mice receiving Pt@mPDA/MnO₂/PDA-Z_Her2 NPs and X-ray irradiation exhibited the most profound inhibition of tumor growth, which was significantly more noticeable higher than that of the mice receiving MnO₂-free Pt@mPDA/PDA-Z_Her2 NPs + X-ray treatment (p < 0.001). These results indicated successful sensitization to RT induced by MnO₂. No obvious body weight changes were observed during any of the treatments for the duration of the experiment (Fig. 8e).

To better understand the mechanisms by which MnO₂ sensitizes cells to RT, the HIF-1α expression level was measured in tumor tissue extracted from each treatment group by an immunofluorescence assay. Compared with that in all MnO₂-free formulation treatment groups, the tumor tissues from the mice treated with Pt@mPDA/MnO₂/PDA NPs showed a remarkable reduction in red fluorescence signal (HIF-1α) (Fig. 9). It indicated that TME in these mice was less hypoxic, which can be attributed to the decomposition of endogenous H₂O₂ to O₂ by MnO₂. Furthermore, with the targeted guiding of Z_Her2 affibody, HIF-1α expression was further reduced by treatment with Pt@mPDA/MnO₂/PDA-Z_Her2 NPs, confirming that the tumor-targeting ability of the Z_Her2 affibody contributed to the sensitization to RT.

Safety evaluation

Evaluation of off-target toxicity is a prerequisite for in vivo use or clinical translation of novel therapeutic agents. Thus, the biocompatibility and biosafety of Pt@mPDA/MnO₂/PDA-Z_Her2 NPs were systematically evaluated by histology and serum biochemistry assays. H&E-stained images of major organs from all treatment mice showed no obvious tissue damage, compared with that from the PBS group (Additional file 1: Fig. S11), suggesting that the drug, materials, or both combined did not cause any significant systemic toxicity. Similarly, the levels of serum biomarkers (ALT, AST, UREA, CREA, and UA) have no significant difference from those in the control group (Additional file 1: Fig. S12), possibly due to the relatively low side effects of clinical cisplatin and biomimetic PDA, as well as the short treatment period. Therefore, this biocompatible nano-theranostic agent exhibits promising potential for clinical translation.

Her2 is overexpressed in a variety of human cancers and is closely related to cell proliferation, differentiation, adhesion, migration, and anti-apoptosis, as well as poor prognosis and rapid recurrence of tumors [48]. Antibody–drug conjugates (ADCs, such as FDA-approved trastuzumab, pertuzumab, and T-DM1), which integrate Her2-specific targeting antibodies with highly cytotoxic small-molecule chemotherapeutic agents, possess the ability to selectively deliver highly potent cytotoxic drugs to tumor sites and have become a powerful cancer-targeting treatment approach. However, these ADCs can have a poor response in the TME and do not offer any diagnostic abilities, as well as being high cost, which limits their wider usage. In the present study, a Her2-targeting Z_Her2 affibody was generated using a genetic engineering approach and successfully coupled to Pt@mPDA/MnO₂/PDA NPs. Compared to the widely used intact antibody, this engineered affibody has the advantage of higher specific affinity, stronger tissue penetrability, higher synthetic yield at a lower price, and low immunogenicity [48, 50]. Such affibodies can be employed to guide nano-agents for enhanced therapeutic efficacy. In addition, in marked contrast to monofunctional antibody–drug conjugates, the Z_Her2 affibody with a nano-agent, which features specific targeting, RT sensitization, and diagnostic abilities, has been prepared and provide a new concept for clinical translation in tumor theranostics.

Conclusion

In the present study, Her2-targeted cisplatin-loaded mPDA/MnO₂/PDA NPs for MR imaging and enhanced chemo-radiotherapy of hypoxic tumors is reported. These NPs are biodegradable under a simulated tumor microenvironment, resulting in accelerated cisplatin release as well as O₂ production by triggering decomposition of H₂O₂. Cell uptake experiments demonstrated that Z_Her2 endowed the NPs with the ability to bind to Her2, achieving enhanced internalization of NPs into Her2-positive SKOV-3 cells. In vivo MRI studies revealed an obvious T₁ contrast enhancement at the tumor site of mice receiving the NPs. Immunofluorescence assays showed that the presence of MnO₂ significantly reduced the expression of HIF-1α and that the Cy5.5 fluorescently-labelled carrier has a high affinity for Her2. Chemotherapy results verified that Pt@mPDA/MnO₂/PDA-Z_Her2 NPs have a strong targeted antitumor efficacy. Combined with X-ray irradiation, the Pt@mPDA/MnO₂/PDA-Z_Her2 NPs can relieve tumor hypoxia and exhibit the superb inhibition of tumor growth. Hence, this multifunctional nanoplatform shows promising potential for clinical translation in tumor theranostics.

Materials and methods

Materials

Pluronic F127 (Mw: 12.6 kDa) was obtained from Sigma-Aldrich (USA). Dopamine hydrochloride (DA·HCl), 1, 3, 5-trimethylbenzene (TMB), dimethyl sulfoxide (DMSO), cisplatin (Pt, 65%), and cyanine-5.5 (Cy5.5) were purchased from Aladdin (Shanghai, China). Ammonium hydroxide (25.0–28.0%), ethanol, potassium permanganate (KMnO₄), and hydrogen peroxide (H₂O₂, 30% v/v) were procured from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). Isopropyl-β-d-thiogalactoside (IPTG), 2-mercaptoethanol (2-ME), 6-carboxyfluorescence (6-FAM), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT), glutathione (GSH), 2,7-dichlorodi-hydrofluorescein diacetate (DCFH-DA), calcein-AM, and propidium iodide (PI) were sourced from Sigma-Aldrich (USA). High-glucose Dulbecco’s modified Eagle’s medium (DMEM), foetal bovine serum, penicillin and streptomycin, trypsin-ethylenediaminetetraacetic acid (trypsin–EDTA), and phosphate-buffered saline (PBS) were obtained from Gibco (Carlsbad, CA). Tris (hydroxymethyl) aminomethane buffer (Tris-buffer, pH 8.6) and McCoy’s 5A medium supplemented with penicillin (100 U/mL) and streptomycin (100 U/mL) were acquired from Jiangsu KeyGEN BioTECH Co., Ltd (Nan**g, China). Human umbilical vein endothelial cells (HUVECs), breast cancer cell line MCF-7, and Her2-positive human ovarian cancer cell line SKOV-3 were provided by the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Deionized (DI) water (> 18.2 MΩ·cm) used for all experiments was purified using a Millipore system, and all chemicals were used without further purification.

Preparation of Pt@mPDA/MnO₂/PDA NPs

Mesoporous polydopamine nanoparticles (mPDA NPs) were synthesized according to a nano-emulsion assembly approach [51] with slight modifications. Pluronic F127 (2.0 g) and DA·HCl (1.0 g) were dissolved in 50% v/v ethanol (200 mL) and stirred at 1000 rpm for 3 h. Then, TMB (1 mL) was added dropwise to the mixture and sonicated for 5 min to allow for generation of the nano-emulsion. After stirring for another 30 min at 500 rpm, NH₄OH (10 mL) was added to the resultant mixture while stirring under aerobic conditions to induce the self-polymerization of dopamine. After another 3 h of continuous reaction and then centrifugation, the mPDA NPs were collected and washed thoroughly with absolute ethanol and then dispersed in PBS for further use. For drug loading, DMSO (200 μL) containing cisplatin (25 mg) was added to the mPDA NPs (50 mg in 50 mL of PBS), followed by sonication for 30 min, and stirring for 24 h in the dark. The cisplatin-loaded mPDA NPs (denoted Pt@mPDA NPs) were collected after centrifugation and washed with DI water.

The Pt@mPDA NPs were re-dispersed into DI water (50 mL, pH 7.4), and KMnO₄ (50 mg) was added while stirring at 400 rpm for 6 h. After sonication for another 6 h, the mixture was centrifuged and washed thoroughly with DI water, yielding Pt@mPDA/MnO₂ NPs. Finally, the Pt@mPDA/MnO₂ NPs were re-dispersed in tris-buffer (100 mL, pH = 8.6), and DA (50 mg) was added. The mixture was stirred (400 rpm) for 4 h, and the NPs were washed with DI water. This yielded Pt@mPDA/MnO₂/PDA NPs, which were re-dispersed into DI water for further use.

Preparation and characterization of the Z_Her2 affibody

The Z_Her2 affibody was expressed and purified according to our previous work [52], with some modifications. In detail, an artificial and optimized gene (5′-GCGGAGGCGAAGTACGCGAAAGAAATGCGTAACGCGTATTGGGAGATCGCGCTGCTGCCGAACCTGACCAACCAGCAAAAGCGTGCGTTCATTCGTAAACTGTACGACGATCCGAGCCAGAGCAGCGAGCTGCTGAGCGAAGCGAAGAAACTGAACGACAGCCAAGCGCCGAAGTGC-3′) encoding Z_Her2 affibody molecule with an added cysteine at the C-terminus of protein was synthesized by GenScript (Nan**g, China) and cloned into pQE30 at the BamHI and SalI sites to construct the expression plasmid pQE30-Z_Her2. The plasmid was transformed into E. coli M15 and induced overnight with 0.05 mM IPTG at 28 °C. Subsequently, the cells were collected by centrifugation, resuspended in lysis buffer (50 mM phosphate, pH 8.0, 300 mM NaCl, and 20 mM imidazole) and sonicated on ice for 30 min to lyse the cells. The recombinant protein in the supernatant was purified using Ni–NTA affinity chromatography according to the manufacturer’s instructions (GenScript, Nan**g, China). The fractions collected during the Z_Her2 preparation process were detected using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed using Image J software (Bethesda, MD, USA). The purified affibody was dialyzed against phosphate-buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na₂HPO₄, and 1.4 mM KH₂PO₄, pH 7.4) and then quantified using a Bradford Protein Assay Kit (Beyotime, Jiangsu, China).

The aggregation form of Z_Her2 was detected using SDS-PAGE with or without 2-mercaptoethanol (2-ME) in the loading buffer. For the specific cell binding assay, Z_Her2 was labelled with 6-FAM (Ruixi Biology, **’an, China) according to the manufacturer’s protocol. In brief, 6-FAM (10 μL; 10 mg/mL in DMF) was added to Z_Her2 solution (5 mL; 2 mg/mL; pH 8.3 in PBS). The reaction was allowed to proceed for 1 h at 25 °C in the dark before the mixture was dialyzed against PBS (pH 7.4) at 4 °C for 48 h to remove unreacted 6-FAM. The conjugation of 6-FAM to the Z_Her2 affibody was verified by SDS-PAGE.

Conjugation of Z_Her2 affibody to NPs

The Pt@mPDA/MnO₂/PDA-Z_Her2 NPs were constructed by conjugating Z_Her2 to Pt@mPDA/MnO₂/PDA NPs via a Michael addition/Schiff base reaction between the amino group and the oxidized quinone form of catechol groups under weak alkaline pH conditions [53, 54]. The Pt@mPDA/MnO₂/PDA NPs were dispersed in tris-buffer (100 mL, 0.5 mg/mL), and Z_Her2 solution (1 mL; 1 mg/mL in PBS) was added, followed by sonication (40 kHz, 70 W) for 30 min. The mixture was then stirred overnight at 25 °C. The unreacted Z_Her2 was removed by centrifugation, and the NPs were thoroughly washed with DI water. This yielded Pt@mPDA/MnO₂/PDA-Z_Her2 NPs, which was re-dispersed in PBS for further use.

Characterization of NPs

The morphology of the NPs was observed by transmission electron microscopy (TEM, JEOL 2010F) at an accelerated voltage of 200 kV. The surface area and pore size of the mPDA NPs were measured using an automated surface area and porosity analyzer (Quantachrome, Autosorb-iQ). X-ray photoelectron spectroscopy (XPS) was performed using a Thermo Fisher ESCALAB 250** spectrometer to determine the chemical state of MnO₂. Zeta potential and particle size distribution were measured using a Malvern Zetasizer (Nano-ZS, Malvern, UK). UV–Vis absorbance spectra were recorded on a UV-2100 spectrophotometer. The concentration of MnO₂, cisplatin, and Z_Her2 in the NPs were analyzed by measuring Mn, Pt, and S elements using inductively coupled plasma-atomic emission spectrometry (ICP-AES, Prodigy, LEEMAN).

Biodegradation and in vitro drug release

Pt@mPDA/MnO₂/PDA NPs were dispersed in PBS (50 mL; pH 7.4) and incubated with different concentration of either (1) H₂O₂ (1 mM); (2) GSH (2 mM); (3) H₂O₂ (1 mM) and GSH (2 mM); (4) H₂O₂ (1 mM), GSH (5 mM) at 37 °C with shaking at 120 rpm for 14 d. At each specified time point, a sample (1 mL) was removed for UV–Vis absorbance measurement. After 2 weeks, each sample was collected and the extent of degradation was determined using TEM.

The concentration of drug released from the NPs was measured according to the dialysis method described previously [14], with some modifications. In brief, Pt@mPDA/MnO₂/PDA NPs (3 mg) were dispersed in PBS (2 mL, pH 7.4) and then loaded into a dialysis bag (MWCO = 7000 Da) and immersed in PBS (18 mL; pH 7.4 and 5.5) containing different concentration of H₂O₂ (0 or 1 mM) and GSH (0 or 5 mM). All samples were incubated at 37 °C with shaking (120 rpm) for 2 days. At predetermined time points, some external medium (1 mL) was removed, and the samples were supplemented with an equal volume of fresh pre-heated medium. The free cisplatin release profile from dialysis bag was measured using the same method. The concentration of the released cisplatin was determined quantitatively by ICP-AES. All experiments were performed in triplicate.

Measurement of dissolved O₂ and detection of ROS in vitro

The ability of MnO₂-based NPs to catalyze the decomposition of H₂O₂ to O₂ was measured using a dissolved oxygen meter (JPSJ-605, INESA). Pt@mPDA/MnO₂/PDA NPs were dispersed in PBS (50 mL; pH 7.4 and 5.5; [MnO₂] = 2 μg/mL) and then transferred into a double-neck flask. H₂O₂ (30% w/v) was added at a final concentration of 1 mM. Blank PBS (pH 7.4) or PBS (pH 7.4) containing H₂O₂ was used as the control medium. The concentration of dissolved O₂ was measured at predetermined time points.

The RT-sensitizing effect of MnO₂-containing NPs caused by catalyzing the decomposition of H₂O₂ to O₂ was measured using a methylene blue (MB) degradation method. MB solution (50 mL; 10 μg/mL) containing H₂O₂ (8 mM) was separately treated with (1) X-Ray (6 Gy), (2) Pt@mPDA/PDA-Z_Her2 NPs (5 mg) + X-Ray (6 Gy), (3) Pt@mPDA/MnO₂/PDA-Z_Her2 (5 mg), (4) Pt@mPDA/MnO₂/PDA-Z_Her2 (5 mg) + X-Ray (6 Gy). After incubation for 30 min at 37 ℃, the MB absorbance of each sample was measured.

GSH-activated T₁-weighted MRI

Pt@mPDA/MnO₂/PDA NPs at different concentrations of Mn ([Mn] = 1 mM, 2 mM, 3 mM, 4 mM, and 5 mM in PBS) were each treated with or without 2 mM GSH. After 20 min, the T₁-weighted relaxation times were measured using a 0.5 T NMI20 NMR Analyzing and Imaging system (Niumag, Shanghai, China) at 25 °C. The test parameters were set according to a previous publication [14]. T₁ relaxivity (r₁) was acquired by fitting a linear function through 1/T₁ as a function of Mn concentration. In addition, T₁ MRI was performed for samples at different concentrations using a clinical MR system (1.5 T, Siemens Magnetom Symphony).

In vitro cellular uptake evaluation

The expression of Her2 in the breast cancer cell line MCF-7 and the human ovarian cancer cell line SKOV-3 was evaluated. MCF-7 and SKOV-3 cells were incubated in DMEM or McCoy’s 5A medium supplemented with 1% v/v penicillin, 1% v/v streptomycin, and 10% v/v foetal bovine serum. The cells were cultured at 37 °C in a 5% CO₂ humidified atmosphere. MCF-7 and SKOV-3 cells (2 × 10⁵) were digested and resuspended in DMEM or McCoy’s 5A medium containing 2 or 4 μg/mL FITC-anti-Her2 antibody (Sino Biological, Bei**g, China) at 37 °C for 2 h. After incubation, the cells were washed three times with PBS and resuspended in PBS (0.5 mL). The FITC fluorescence intensity was determined using a Becton–Dickinson FACScan analyzer (Frankin, CA, USA). Three independent experiments were conducted. Visualization of the distribution of FITC-anti-Her2 antibody in cells was further analyzed by confocal laser scanning microscopy (CLSM, Carl Zeiss LSM 700). Specifically, MCF-7 or SKOV-3 cells were seeded into 24-well plates and cultured at 37 °C. After 12 h, the cells were incubated with 2 or 4 μg/mL FITC-anti-Her2 antibody for a further 2 h. The cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 min at 4 °C, and then washed again three times with PBS. Finally, the cells were immediately observed using CLSM.

The specific affinity between Z_Her2 and Her2-positive cancer cell lines was evaluated. Her2-negative MCF-7 cells or Her2-positive SKOV-3 cells were seeded in a confocal dish (5 × 10⁴ cells per dish) and incubated for 12 h. Thereafter, the medium was aspirated and replaced with fresh medium containing FAM-Z_Her2 (2 mL; 50 μg/mL). After another 2 h of incubation, the cells were washed three times with PBS and then fixed with 4% paraformaldehyde for 15 min at 4 °C. The cell nuclei were stained with DAPI (1 mL, 10 μg/mL) for 5 min and then washed three times with PBS. Finally, the cells were immediately observed using CLSM. The affinity between FAM-Z_Her2 and SKOV-3 cells was also evaluated by flow cytometry (FCM). Approximately 2 × 10⁵ digested cells were incubated with FAM-Z_Her2 (50 μg/mL) at 37 °C for 2 h. For Her2 receptor blocking experiments, SKOV-3 cells were pre-incubated with Z_Her2 (20 μg/mL) for 1 h and then incubated with FAM-Z_Her2 (50 μg/mL) for another 2 h. After that, the cells were washed three times with PBS and re-dispersed in PBS (0.5 mL) for FCM assay.

FCM was used to evaluate the affinity of monomeric and dimeric affibodies to Her2 receptors. Briefly, SKOV-3 cells (2 × 10⁵) were digested and incubated with the same molar concentration (100 nM) of monomeric (in the presence of 2-ME) or dimeric (in the absence of 2-ME) FAM-Her2 affibody at 37 °C for 2 h. After incubation, the cells were washed three times with PBS and redispersed in PBS (0.5 mL). The FAM fluorescence intensity was determined by FCM.

To visually track the distribution of the NPs in cells, Cy5.5-loaded NPs (Cy5.5@mPDA/MnO₂/PDA or Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs) were prepared following the same method as described above. The SKOV-3 cellular uptake of these NPs was evaluated following a protocol similar to that described above, except that an FBS-free medium containing Cy5.5@mPDA/MnO₂/PDA or Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs (50 μg/mL; in PBS) was added after the initial culture. To investigate Her2-dependent binding, SKOV-3 cells were pre-incubated with free Z_Her2 (20 μg/mL) for 1 h prior to incubation with Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs (50 μg/mL). Finally, the cells were treated and probed by CLSM as described above.

FCM was performed to semi-quantify the uptake of these two NPs by SKOV-3 cells. Approximately 2 × 10⁵ cells were incubated with Cy5.5@mPDA/MnO₂/PDA or Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs (50 μg/mL; in PBS) after a 1 h pre-treatment with or without free Z_Her2 (20 μg/mL). After 4 h incubation at 37 °C, the cells were washed three times with PBS and re-dispersed in 0.5 mL PBS for FCM analysis.

Cytotoxicity assays

The cytocompatibility of drug-free mPDA/MnO₂/PDA-Z_Her2 NPs to HUVECs was first determined by performing the MTT assay. HUVECs (~ 1 × 10⁴) were seeded into 96-well plates and cultured overnight at 37 °C in a 5% CO₂ humidified environment. The medium was replaced with fresh DMEM (200 μL) containing different concentrations of mPDA/MnO₂/PDA-Z_Her2 NPs (1, 5, 10, 20, 50, 100, and 250 μg/mL), and the cells were incubated for another 24 h. Subsequently, the medium of each well was carefully discarded followed by the addition of MTT solution (20 μL, 10 μg/mL), and the cells were incubated for an additional 4 h. Finally, DMSO (200 μL) was added after removing the medium, and the absorbance of the wells at 570 nm was measured with a microplate reader (Multiskan FC, Thermo Scientific).

The in vitro anticancer efficacy of different cisplatin formulations was investigated using a method similar to that described above, except that medium (200 μL) containing free cisplatin, Pt@mPDA/MnO₂/PDA NPs, or Pt@mPDA/MnO₂/PDA-Z_Her2 NPs ([cisplatin] = 0.6, 3, 6, 12, 24, or 48 μg/mL) was added after the initial incubation. Data are reported as mean ± S.D., with three independently performed experiments each containing three replicates. The cells treated with free cisplatin, Pt@mPDA/MnO₂/PDA NPs, or Pt@mPDA/MnO₂/PDA-Z_Her2 NPs ([cisplatin] = 48 μg/mL) for 24 h were further stained with PI (staining dead cells red) and calcein-AM (staining live cells green) in PBS solution for 30 min at 37 °C in the dark and then imaged by inverted fluorescence microscopy (Carl Zeiss). For all experiments, PBS-treated cells were used as the control.

Measurement of intracellular ROS levels

The levels of intracellular ROS were measured using DCFH-DA to evaluate the RT-sensitizing effect of MnO₂. SKOV-3 cells were seeded onto 24-well plates at 50,000 cells/well and maintained in McCoy’s 5A medium. After 12 h incubation at 37 °C, cells were treated with either (1) PBS, (2) PBS + X-ray, (3) MnO₂-free mPDA/PDA-Z_Her2 NPs (50 μg/mL; in PBS) + X-ray, (4) mPDA/MnO₂/PDA-Z_Her2 NPs (50 μg/mL; in PBS), and (5) mPDA/MnO₂/PDA-Z_Her2 NPs (50 μg/mL; in PBS) + X-ray. In samples receiving X-ray treatment, the cells were irradiated with X-rays (6 Gy) after 4 h of incubation. After an additional 1 h of incubation, DCFH-DA solution (1 mL; 10 μM) was added to the cells for another 30 min. Subsequently, the fluorescence images were acquired with inverted fluorescence microscopy (Carl Zeiss).

Hemocompatibility assay

Fresh blood was obtained from female Sprague–Dawley (SD) rats and centrifuged at 1500 rpm for 15 min to separate red blood cells (RBCs). RBCs were then treated with a suspension of Pt@mPDA/MnO₂/PDA NPs or Pt@mPDA/MnO₂/PDA-Z_Her2 NPs in PBS (5 mL, 250 μg/mL). PBS (5 mL; pH 7.4) and Triton X-100 (5 mL; 1% w/v) were used as negative controls and positive controls, respectively. Each sample was incubated at 37 ℃ for 1 h, and the intact RBCs were separated by centrifugation (1500 rpm; 15 min). The supernatant from each tube was collected and the amount of hemoglobin release was determined by reading the absorbance at 540 nm in a microplate reader (Multiskan FC, Thermo Scientific). The formula below was used to calculate the percentage of RBC hemolysis and each experiment was conducted in triplicate.

$${\text{Hemolysis }}\% \, = \, \left( {{\text{OD }}\left[ {{\text{test}}} \right] \, {-}{\text{ OD }}\left[ {\text{negative control}} \right]} \right) \times { 1}00/{\text{OD }}\left[ {\text{positive control}} \right]$$

Animals and tumor model

All animal experiments were carried out with full authorization by the ethics committee for animal care of Shandong Cancer Hospital and Institute Shandong, First Medical University and Shandong Academy of Medical Sciences (Approval No. SDTHEC2020004083). Female BALB/C nude mice (SPF grade, 4–6 weeks old) were acquired from Bei**g Huafukang Bioscience Co. Inc. (Bei**g, China). Tumors were established by subcutaneous injection of SKOV-3 cells (1 × 10⁶) dispersed in PBS (100 μL) into the right flank of each mouse. The tumor volume was monitored in real-time and calculated as length × width²/2.

In vivo MRI and biodistribution

In order to demonstrate the TME-triggered MRI ability of the MnO₂ layer, PBS (50 μL) containing Pt@mPDA/MnO₂/PDA NPs ([Mn] = 50 mM) was indirectly injected into the tumor sites or the muscle on the opposite side to the tumors. At pre-determined time points (0 min, 5 min, and 120 min), the SKOV-3 tumor-bearing mice were scanned using an MR analysis and imaging system (1.5 T, Siemens Magnetom Symphony).

When the tumor volume reached approximately 200 mm³, Pt@mPDA/MnO₂/PDA NPs or Pt@mPDA/MnO₂/PDA-Z_Her2 NPs ([Mn] = 3 mM, 100 μL in PBS per mouse) were intravenously injected into the tumor-bearing mice, and T₁-weighted MR images were obtained at different time points after injection. The following MR scanning parameters were used: TE = 16.9 ms, TR = 760 ms, FOV = 10 cm × 10 cm, slice thickness = 3 mm, and point resolution = 512 mm × 512 mm.

The mice were sacrificed at 12 h after receiving NPs, and the heart, liver, spleen, lung, kidney, brain, muscle, and tumors were extracted and weighed and then dissolved in aqua regia solution (2 mL, 65 °C) for 24 h. The mice intravenously injected with free cisplatin (200 μL; 200 μg/mL in PBS) were used as control group. Finally, the Pt content in each tissue and tumor was quantified by ICP-AES.

Immunofluorescence and bio-TEM assays

The SKOV-3 tumor-bearing mice were intravenously injected with PBS containing Cy5.5@mPDA/MnO₂/PDA NPs or Cy5.5@mPDA/MnO₂/PDA-Z_Her2 NPs (100 μL; 1 mg/mL). For the immunofluorescence assay, tumors were collected at 12 h post-injection and fixed with OCT (Sakura) for cryo-sectioning. The tumor sections were incubated overnight with a rabbit anti-mouse Her2 primary antibody (dilution 1:200, Abcam) at 4 °C and then for 60 min with a goat anti-rabbit secondary antibody (dilution 1:200, Abcam) at 37 °C. The cell nuclei were stained with DAPI. Finally, the obtained slices were scanned using an imaging system (Nikon DS-U3).

For bio-TEM, tumors were treated with 1% OsO₄ for 2 h at 25 °C, then embedded in resin after the cells were dehydrated. Ultrathin sections(70–90 nm) of tumor tissue were cut and analyzed by bio-TEM (Hitachi HT7700, Tokyo, Japan).

In vivo antitumor efficacy and safety evaluation

When the volume of tumors reached ~ 50 mm³, the tumor-bearing mice were randomly divided into four groups (n = 5) and intravenously injected with either (1) PBS, (2) free cisplatin in PBS, (3) Pt@mPDA/MnO₂/PDA NPs in PBS, or (4) Pt@mPDA/MnO₂/PDA-Z_Her2 NPs in PBS (200 μL; dose of cisplatin = 2 mg/kg) every 2 days. Tumor volume and body weights were monitored and recorded every day after the first injection. On the 14^th day, 0.5 mL of blood from each group of mice (n = 3) was withdrawn, after which the experiment was halted. The tumors were collected and stained with terminal deoxynucleotidyl transferase UTP nick end labelling (TUNEL) for the apoptosis assay, while the major organs (heart, liver, spleen, lung, and kidney) were extracted and stained with haematoxylin and eosin (H&E) for histological analysis.

For chemo-radiation combined therapy, when the volume of tumors reached ~ 50 mm³, four groups of tumor-bearing mice (n = 5) were treated with either (5) PBS (200 μL), (6) PBS (200 μL) + X-ray, (7) MnO₂-free Pt@mPDA/PDA-Z_Her2 NPs in PBS (200 μL) + X-ray, or (8) Pt@mPDA/MnO₂/PDA-Z_Her2 NPs in PBS (200 μL) + X-ray. All groups of mice except for group (5) received cisplatin and MnO₂ doses of 2 mg/kg and 3.4 mg/kg, respectively, every 2 days. For radiotherapy, mice received X-ray radiation at a dose of 6 Gy for 24 h post-injection every 4 days. Tumor sizes and body weights were recorded every day. After 14 days the mice were sacrificed, and tumors were collected for volume measurement and weighing. Finally, to evaluate tumor hypoxia levels, the tumor tissues from groups (1)–(4) and group (7) were HIF-1α stained according to the manufacturer’s instructions.

Statistical analysis

All results are presented as mean ± standard deviation (S.D.), and between-group comparisons were evaluated using one-way ANOVA. A p value < 0.05 indicates statistical significance, and data are represented as (*) for p < 0.05, (**) for p < 0.01, and (***) for p < 0.001. NS stands for not statistically significant.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Abbreviations

RT:: Radiotherapy
ROS:: Reactive oxygen species
TME:: Tumor microenvironment
HIF-1α:: Hypoxia-inducible factor 1α
MRI:: Magnetic resonance imaging
Her2:: Human epidermal growth factor receptor 2
Pt:: Cisplatin
mPDA:: Mesoporous polydopamine

References

Ross G. Induction of cell death by radiotherapy. Endocr Relat Cancer. 1999;6:41–4.
Article CAS PubMed Google Scholar
Li Y, Yun K-H, Lee H, Goh S-H, Suh Y-G, Choi Y. Porous platinum nanoparticles as a high-Z and oxygen generating nanozyme for enhanced radiotherapy in vivo. Biomaterials. 2019;197:12–9.
Article CAS PubMed Google Scholar
Herrera FG, Bourhis J, Coukos G. Radiotherapy combination opportunities leveraging immunity for the next oncology practice. CA Cancer J Clin. 2017;67:65–85.
Article PubMed Google Scholar
Harrington KJ, Billingham LJ, Brunner TB, Burnet NG, Chan CS, Hoskin P, Mackay RI, Maughan TS, Macdougall J, Mckenna WG. Guidelines for preclinical and early phase clinical assessment of novel radiosensitisers. Brit J Cancer. 2011;105:628–39.
Article CAS PubMed PubMed Central Google Scholar
Barker HE, Paget JT, Khan AA, Harrington KJ. The tumour microenvironment after radiotherapy: mechanisms of resistance and recurrence. Nat Rev Cancer. 2015;15:409–25.
Article CAS PubMed PubMed Central Google Scholar
Semenza GL. Intratumoral hypoxia, radiation resistance, and HIF-1. Cancer Cell. 2004;5:405–6.
Article CAS PubMed Google Scholar
Maier A, Anegg U, Fell B, Rehak P, Ratzenhofer B, Tomaselli F, Sankin O, Pinter H, Smolle-Jüttner FM, Friehs GB. Hyperbaric oxygen and photodynamic therapy in the treatment of advanced carcinoma of the cardia and the esophagus. Laser Surg Med. 2015;26:308–15.
Article Google Scholar
Alwaili NS, Butler GJ, Beale J, Hamilton RW, Lee BY, Lucas P. Hyperbaric oxygen and malignancies: a potential role in radiotherapy, chemotherapy, tumor surgery and phototherapy. Med Sci Monit. 2005;11:RA279-289.
Google Scholar
Fingar VH, Mang TS, Henderson BW. Modification of photodynamic therapy-induced hypoxia by Fluosol-DA (20%) and carbogen breathing in mice. Cancer Res. 1988;48:3350–4.
CAS PubMed Google Scholar
Goswami N, Luo Z, Yuan X, Leong DT, **e J. Engineering gold-based radiosensitizers for cancer radiotherapy. Mater Horiz. 2017;4:817–31.
Article CAS Google Scholar
Yang B, Chen Y, Shi J. Nanocatalytic medicine. Adv Mater. 2019;31:e1901778.
Article PubMed CAS Google Scholar
Gao M, Liang C, Song X, Chen Q, ** Q, Wang C, Liu Z. Erythrocyte-membrane-enveloped perfluorocarbon as nanoscale artificial red blood cells to relieve tumor hypoxia and enhance cancer radiotherapy. Adv Mater. 2017;29:1701429.
Article CAS Google Scholar
Chen Q, Chen J, Yang Z, Xu J, Xu L, Liang C, Han X, Liu Z. Nanoparticle-enhanced radiotherapy to trigger robust cancer immunotherapy. Adv Mater. 2019;31:e1802228.
Article PubMed CAS Google Scholar
Wang H, Bremner DH, Wu K, Gong X, Fan Q, **e X, Zhang H, Wu J, Zhu L-M. Platelet membrane biomimetic bufalin-loaded hollow MnO₂ nanoparticles for MRI-guided chemo-chemodynamic combined therapy of cancer. Chem Eng J. 2020;382:122848.
Article CAS Google Scholar
Lin LS, Song J, Song L, Ke K, Liu Y, Zhou Z, Shen Z, Li J, Yang Z, Tang W, et al. simultaneous fenton-like ion delivery and glutathione depletion by MnO₂-based nanoagent enhances chemodynamic therapy. Angew Chem Int Ed Engl. 2018;57:4902–6.
Article CAS PubMed Google Scholar
Alizadeh N, Salimi A. Multienzymes activity of metals and metal oxide nanomaterials: applications from biotechnology to medicine and environmental engineering. J Nanobiotechnol. 2021;19:26.
Article CAS Google Scholar
Yang X, Yang Y, Gao F, Wei JJ, Qian CG, Sun MJ. Biomimetic hybrid nanozymes with self-supplied H(+) and accelerated O₂ generation for enhanced starvation and photodynamic therapy against hypoxic tumors. Nano Lett. 2019;19:4334–42.
Article CAS PubMed Google Scholar
Wang D, Wu H, Lim WQ, Phua SZF, Xu P, Chen Q, Guo Z, Zhao Y. A mesoporous nanoenzyme derived from metal-organic frameworks with endogenous oxygen generation to alleviate tumor hypoxia for significantly enhanced photodynamic therapy. Adv Mater. 2019;31:e1901893.
Article PubMed CAS Google Scholar
Chen Q, Feng L, Liu J, Zhu W, Dong Z, Wu Y, Liu Z. Intelligent albumin-MnO₂ nanoparticles as pH-/H₂O₂-responsive dissociable nanocarriers to modulate tumor hypoxia for effective combination therapy. Adv Mater. 2016;28:7129–36.
Article CAS PubMed Google Scholar
Sun Q, Wang Z, Liu B, Jia T, Yang P. Self-generation of oxygen and simultaneously enhancing photodynamic therapy and MRI effect: an intelligent nanoplatform to conquer tumor hypoxia for enhanced phototherapy. Chem Eng J. 2020;390:124624.
Article CAS Google Scholar
Yang G, Xu L, Chao Y, Xu J, Sun X, Wu Y, Peng R, Liu Z. Hollow MnO₂ as a tumor-microenvironment-responsive biodegradable nano-platform for combination therapy favoring antitumor immune responses. Nat Commun. 2017;8:902.
Article PubMed PubMed Central CAS Google Scholar
Falk S. Principles of cancer treatment by radiotherapy. Surg Infect (Larchmt). 2003;21:269–72.
Google Scholar
Vlahov IR, Leamon CP. Engineering folate-drug conjugates to target cancer: from chemistry to clinic. Bioconjug Chem. 2012;23:1357–69.
Article CAS PubMed Google Scholar
Fang Y, Jiang Y, Zou Y, Meng F, Zhang J, Deng C, Sun H, Zhong Z. Targeted glioma chemotherapy by cyclic RGD peptide-functionalized reversibly core-crosslinked multifunctional poly(ethylene glycol)-b-poly(epsilon-caprolactone) micelles. Acta Biomater. 2017;50:396–406.
Article CAS PubMed Google Scholar
Mu D, Li J, Qi Y, Sun X, Liu Y, Shen S, Li Y, Xu B, Zhang B. Hyaluronic acid-coated polymeric micelles with hydrogen peroxide scavenging to encapsulate statins for alleviating atherosclerosis. J Nanobiotechnol. 2020;18:179.
Article CAS Google Scholar
Brekken RA, Overholser JP, Stastny VA, Waltenberger J, Minna JD, Thorpe PE. Selective inhibition of vascular endothelial growth factor (VEGF) receptor 2 (KDR/Flk-1) activity by a monoclonal anti-VEGF antibody blocks tumor growth in mice. Cancer Res. 2000;60:5117–24.
CAS PubMed Google Scholar
Noonberg SB, Benz DCC. Tyrosine kinase inhibitors targeted to the epidermal growth factor receptor subfamily. Drugs. 2000;59:753–67.
Article CAS PubMed Google Scholar
Pant K, Neuber C, Zarschler K, Wodtke J, Meister S, Haag R, Pietzsch J, Stephan H. Active tumor targeting: active targeting of dendritic polyglycerols for diagnostic cancer imaging. Small. 2020;16:1905013.
Article CAS Google Scholar
Allen TM. Ligand-targeted therapeutics in anticancer therapy. Nat Rev Cancer. 2002;2:750–63.
Article CAS PubMed Google Scholar
Fang RH, Kroll AV, Gao W, Zhang L. Cell membrane coating nanotechnology. Adv Mater. 2018;30:1706759.
Article CAS Google Scholar
Akhtari J, Rezayat SM, Teymouri M, Alavizadeh SH, Gheybi F, Badiee A, Jaafari MR. Targeting, bio distributive and tumor growth inhibiting characterization of anti-HER2 affibody coupling to liposomal doxorubicin using BALB/c mice bearing TUBO tumors. Int J Pharmaceut. 2016;505:89–95.
Article CAS Google Scholar
Simeon R, Chen Z. In vitro-engineered non-antibody protein therapeutics. Protein Cell. 2018;9:3–14.
Article CAS PubMed Google Scholar
Friedman M, Stahl S. Engineered affinity proteins for tumour-targeting applications. Biotechnol Appl Bioc. 2009;53:1–29.
Article CAS Google Scholar
Lendel C, Dogan J, Hard T. Structural basis for molecular recognition in an affibody:affibody complex. J Mol Biol. 2006;359:1293–304.
Article CAS PubMed Google Scholar
Cui L, Zhang F, Wang Q, Lin H, Yang C, Zhang T, Tong R, An N, Qu F. NIR light responsive core–shell nanocontainers for drug delivery. J Mater Chem B. 2015;3:7046–54.
Article CAS PubMed Google Scholar
Orlova A, Feldwisch J, Abrahmsen L, Tolmachev V. Update: affibody molecules for molecular imaging and therapy for cancer. Cancer Biother Radio. 2007;22:573–84.
CAS Google Scholar
Lofblom J, Feldwisch J, Tolmachev V, Carlsson J, Stahl S, Frejd FY. Affibody molecules: engineered proteins for therapeutic, diagnostic and biotechnological applications. FEBS Lett. 2010;584:2670–80.
Article CAS PubMed Google Scholar
Wikman M, Steffen AC, Gunneriusson E, Tolmachev V, Adams GP, Carlsson J, Stahl S. Selection and characterization of HER2/neu-binding affibody ligands. Protein Eng Des Sel. 2004;17:455–62.
Article CAS PubMed Google Scholar
Orlova A, Magnusson M, Eriksson TL, Nilsson M, Larsson B, Hoiden-Guthenberg I, Widstrom C, Carlsson J, Tolmachev V, Stahl S, Nilsson FY. Tumor imaging using a picomolar affinity HER2 binding affibody molecule. Cancer Res. 2006;66:4339–48.
Article CAS PubMed Google Scholar
Feldwisch J, Tolmachev V, Lendel C, Herne N, Sjoberg A, Larsson B, Rosik D, Lindqvist E, Fant G, Hoiden-Guthenberg I, et al. Design of an optimized scaffold for affibody molecules. J Mol Biol. 2010;398:232–47.
Article CAS PubMed Google Scholar
Ahlgren S, Orlova A, Wallberg H, Hansson M, Sandstrom M, Lewsley R, Wennborg A, Abrahmsen L, Tolmachev V, Feldwisch J. Targeting of HER2-expressing tumors using 111In-ABY-025, a second-generation affibody molecule with a fundamentally reengineered scaffold. J Nucl Med. 2010;51:1131–8.
Article CAS PubMed Google Scholar
Sandstrom M, Lindskog K, Velikyan I, Wennborg A, Feldwisch J, Sandberg D, Tolmachev V, Orlova A, Sorensen JN, Carlsson J. Biodistribution and radiation dosimetry of the anti-HER2 affibody molecule 68Ga-ABY-025 in breast cancer patients. J Nucl Med. 2016;57:867–71.
Article PubMed CAS Google Scholar
Cheng W, Zeng X, Chen H, Li Z, Zeng W, Mei L, Zhao Y. Versatile polydopamine platforms: synthesis and promising applications for surface modification and advanced nanomedicine. ACS Nano. 2019;13:8537–65.
Article CAS PubMed Google Scholar
Cheng W, Liang C, Xu L, Liu G, Gao N, Tao W, Luo L, Zuo Y, Wang X, Zhang X. TPGS-functionalized polydopamine-modified mesoporous silica as drug nanocarriers for enhanced lung cancer chemotherapy against multidrug resistance. Small. 2017;29:1700623.
Article CAS Google Scholar
Bao X, Zhao J, Sun J, Hu M, Yang X. Polydopamine nanoparticles as efficient scavengers for reactive oxygen species in periodontal disease. ACS Nano. 2018;12:8882–92.
Article CAS PubMed Google Scholar
Shi Q, Tao Z, Yang H, Fan Q, Wei D, Wan L, Lu X. PDGFRβ-specific affibody-directed delivery of a photosensitizer, IR700, is efficient for vascular-targeted photodynamic therapy of colorectal cancer. Drug Deliv. 2017;24:1818–30.
Article CAS PubMed PubMed Central Google Scholar
Tao Z, Yang H, Shi Q, Fan Q, Wan L, Lu X. Targeted delivery to tumor-associated pericytes via an affibody with high affinity for PDGFRbeta enhances the in vivo antitumor effects of human TRAIL. Theranostics. 2017;7:2261–76.
Article CAS PubMed PubMed Central Google Scholar
Zhang H, Wang Y, Wu Y, Jiang X, Tao Y, Yao Y, Peng Y, Chen X, Fu Y, Yu L, et al. Therapeutic potential of an anti-HER2 single chain antibody-DM1 conjugates for the treatment of HER2-positive cancer. Signal Transduct Tar. 2017;2:17015.
Article Google Scholar
Kim H, Kim S, Park C, Lee H, Park HJ, Kim C. Glutathione-induced intracellular release of guests from mesoporous silica nanocontainers with cyclodextrin gatekeepers. Adv Mater. 2010;22:4280–3.
Article CAS PubMed Google Scholar
Orlova A, Magnusson M, Eriksson TLJ, Nilsson M, Nilsson FY. Tumor imaging using a picomolar affinity HER2 binding affibody molecule. Cancer Res. 2006;66:4339–48.
Article CAS PubMed Google Scholar
Peng L, Hung CT, Wang S, Zhang X, Zhu X, Zhao Z, Wang C, Tang Y, Li W, Zhao D. Versatile nanoemulsion assembly approach to synthesize functional mesoporous carbon nanospheres with tunable pore sizes and architectures. J Am Chem Soc. 2019;141:7073–80.
Article CAS PubMed Google Scholar
Fan Q, Tao Z, Yang H, Shi Q, Wang H, Jia D, Wan L, Zhang J, Cheng J, Lu X. Modulation of pericytes by a fusion protein comprising of a PDGFRbeta-antagonistic affibody and TNFalpha induces tumor vessel normalization and improves chemotherapy. J Control Release. 2019;302:63–78.
Article CAS PubMed Google Scholar
Das MK, Sarma A, Deka T. Polydopamine-based simple and versatile surface modification of polymeric nano drug carriers. ACS Nano. 2014;8:3347–56.
Article CAS Google Scholar
Han X, Xu Y, Li Y, Zhao X, Zhang Y, Min H, Qi Y, Anderson GJ, You L, Zhao Y, Nie G. An extendable star-like nanoplatform for functional and anatomical imaging-guided photothermal oncotherapy. ACS Nano. 2019;13:4379–91.
Article CAS PubMed Google Scholar

Download references

Acknowledgements

The authors would like to thank the Professor David Bremner for his assistance in revision of the manuscript and Instrumental Analysis Centre of Donghua University for materials testing.

Funding

This investigation was supported by the Youth Outstanding Reserve Talents Program of Shandong First Medical University and Shandong Academy of Medical Sciences, the grant 16410723700 from the Science and Technology Commission of Shanghai Municipality, Natural Science Foundation of Shandong Province (ZR2019PH006, ZR2020QH347), Youth Innovative Science and Technology Program of Shandong Colleges and University (2019KJM012), the Shandong Provincial Key Research Development Program (2018GSF118175).

Author information

Haijun Wang and Dianlong Jia contributed equally to this work

Authors and Affiliations

Department of Pharmacy, Shandong Cancer Hospital and Institute, Shandong First Medical University and Shandong Academy of Medical Sciences, **an, 250117, China
Haijun Wang, Wenna Shi, Hui Li & Qing Fan
College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai, 201620, China
Li-Min Zhu
Laboratory of Drug Discovery and Design, School of Pharmacy, Liaocheng University, Liaocheng, 252000, China
Dianlong Jia & Feifei Wang
School of Life Sciences, Shandong First Medical University and Shandong Academy of Medical Sciences, Taian, 271016, China
Haijun Wang & **aolei Yin
Department of Digestive Oncology, Shandong Cancer Hospital and Institute, Shandong First Medical University and Shandong Academy of Medical Sciences, **an, 250117, China
Dandan Yuan
Joint Laboratory for Translational Medicine Research, Liaocheng People’s Hospital, Liaocheng, 252000, China
Fengjiao Yuan

Authors

Haijun Wang
View author publications
You can also search for this author in PubMed Google Scholar
Dianlong Jia
View author publications
You can also search for this author in PubMed Google Scholar
Dandan Yuan
View author publications
You can also search for this author in PubMed Google Scholar
**aolei Yin
View author publications
You can also search for this author in PubMed Google Scholar
Fengjiao Yuan
View author publications
You can also search for this author in PubMed Google Scholar
Feifei Wang
View author publications
You can also search for this author in PubMed Google Scholar
Wenna Shi
View author publications
You can also search for this author in PubMed Google Scholar
Hui Li
View author publications
You can also search for this author in PubMed Google Scholar
Li-Min Zhu
View author publications
You can also search for this author in PubMed Google Scholar
Qing Fan
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

HW, QF and LZ designed the experiment, analyzed the data and drafted the manuscript. HW prepared and characterized the Pt@mPDA/MnO₂/PDA-Z_Her2 NPs, FW and DJ prepared Z_Her2. HW and QF performed the animal experiments. DY, XY, FY, WN and NL assisted with the in vitro and in vivo experiments. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Li-Min Zhu or Qing Fan.

Ethics declarations

Ethics approval and consent to participate

All animal experiments were carried out with full authorization approved by the ethical committee for animal care of Shandong Cancer Hospital and Institute Shandong, First Medical University and Shandong Academy of Medical Sciences (Approval No. SDTHEC2020004083).

Consent for publication

All authors agree to be published.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Fig. S1.

(a) N₂ adsorption/desorption isotherms of mPDA NPs and (b) the corresponding pore-size distribution curves. (c) Zeta potential values of cisplatin, mPDA, Pt@mPDA, Pt@mPDA/MnO₂ and Pt@mPDA/MnO₂/PDA NPs dispersed in water (pH 7.4). Fig. S2. (a) XPS full survey spectra and (b) Mn 2p XPS spectra of mPDA/MnO₂/PDA NPs. Fig. S3. UV–Vis absorption spectra of Pt@mPDA/MnO₂/PDA NPs in (a) blank PBS (pH 7.4) and PBS (pH 7.4) containing (b) 1 mM H₂O₂, (c) 2 mM GSH, (d) 1 mM H₂O₂ + 2 mM GSH, and (e) 1 mM H₂O₂ + 5 mM GSH at different time points; (f) the absorption spectra comparison of aqueous dispersions of NPs after 14 d under different conditions. Fig. S4. UV–Vis absorption spectra of MB solution after treating with X-ray (6 Gy), Pt@mPDA/PDA NPs + X-ray (6 Gy), Pt@mPDA/MnO₂/PDA NPs, and Pt@mPDA/MnO₂/PDA NPs + X-ray (6 Gy) for 30 min. Blank MB solution was used as control. Fig. S5. (a) DLS sizes of Pt@mPDA/MnO₂/PDA and Pt@mPDA/MnO₂/PDA-Z_Her2 NPs in water. (b) DLS sizes of Pt@mPDA/MnO₂/PDA and Pt@mPDA/MnO₂/PDA-Z_Her2 NPs in PBS over 24 h; Fig. S6. FCM data for (a) MCF-7 or (b) SKOV-3 cells after treatment with PBS, 2 or 4 μg/mL of FITC-labelled anti-Her2 antibody for 2 h and showing the corresponding quantified fluorescence intensity. (c) Fluorescence images for MCF-7 or SKOV-3 cells after treatment with PBS and 2 or 4 μg/mL of FITC-labelled anti-Her2 antibody for 2 h. Fig. S7. (a) CLSM images of MCF-7 and SKOV-3 cells after 2 h incubation with FAM-Z_Her2. (b) Flow cytometry data for: untreated SKOV-3 cells; SKOV-3 cells incubated for 2 h with FAM-Z_Her2 and cells pre-incubated with Z_Her2 for 1 h before being exposed to FAM-Z_Her2 for 2 h, and corresponding quantified fluorescence intensity. Fig. S8. (a) Flow cytometry data for: untreated SKOV-3 cells; SKOV-3 cells incubated for monomeric (in the presence of 2-ME) or dimeric (in the absence of 2-ME) FAM-Her2 affibody at 37 °C for 2 h. (b) MTT viability results for HUVECs treated with different concentration of mPDA/MnO₂/PDA-Z_Her2 NPs. Fig. S9. (a) Microscope images of RBCs incubated with (II) PBS, (II) Triton-100, (III) Pt@mPDA/MnO₂/PDA NPs, (IV) Pt@mPDA/MnO₂/PDA-Z_Her2 NPs and (b) corresponding pictures after centrifugation (5000 rpm, 10 min). (c) Hemocompatibility data. Fig. S10. Biodistribution of free cisplatin (Pt), Pt@mPDA/MnO₂/PDA and Pt@mPDA/MnO₂/PDA-Z_Her2 NPs in mice bearing SKOV-3 tumor grafts. Fig. S11. Representative H&E-stained images of the major organs collected after in vivo chemotherapy experiment. Fig. S12. Blood biochemical analyses of the mice from chemotherapy experiment.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article

Wang, H., Jia, D., Yuan, D. et al. Dimeric Her2-specific affibody mediated cisplatin-loaded nanoparticles for tumor enhanced chemo-radiotherapy. J Nanobiotechnol 19, 138 (2021). https://doi.org/10.1186/s12951-021-00885-6

Download citation

Received: 08 February 2021
Accepted: 06 May 2021
Published: 13 May 2021
DOI: https://doi.org/10.1186/s12951-021-00885-6

Dimeric Her2-specific affibody mediated cisplatin-loaded nanoparticles for tumor enhanced chemo-radiotherapy

Abstract

Background

Results

Conclusions

Graphic abstract

Similar content being viewed by others

Fabrication, characterization, and biological evaluation of anti-HER2 indocyanine green-doxorubicin-encapsulated PEG-b-PLGA copolymeric nanoparticles for targeted photochemotherapy of breast cancer cells

Optimizing cisplatin delivery to triple-negative breast cancer through novel EGFR aptamer-conjugated polymeric nanovectors

Targeting triple‐negative breast cancer with an aptamer‐functionalized nanoformulation: a synergistic treatment that combines photodynamic and bioreductive therapies

Background

Her2-positive cell-specific binding and cytotoxicity assay

Hemolysis assay in vitro

Tumor targeting profiles in vivo

In vivo chemo-sensitized radiotherapy

Safety evaluation

Conclusion

Materials and methods

Materials

Preparation of Pt@mPDA/MnO2/PDA NPs

Preparation and characterization of the ZHer2 affibody

Conjugation of ZHer2 affibody to NPs

Characterization of NPs

Biodegradation and in vitro drug release

Measurement of dissolved O2 and detection of ROS in vitro

GSH-activated T1-weighted MRI

In vitro cellular uptake evaluation

Cytotoxicity assays

Measurement of intracellular ROS levels

Hemocompatibility assay

Animals and tumor model

In vivo MRI and biodistribution

Immunofluorescence and bio-TEM assays

In vivo antitumor efficacy and safety evaluation

Statistical analysis

Availability of data and materials

Abbreviations

References

Acknowledgements

Funding

Author information

Authors and Affiliations

Contributions

Corresponding authors

Ethics declarations

Ethics approval and consent to participate

Consent for publication

Competing interests

Additional information

Publisher's Note

Supplementary Information

Additional file 1: Fig. S1.

Rights and permissions

About this article

Cite this article

Share this article

Keywords

Search

Navigation

Preparation of Pt@mPDA/MnO₂/PDA NPs

Preparation and characterization of the Z_Her2 affibody

Conjugation of Z_Her2 affibody to NPs

Measurement of dissolved O₂ and detection of ROS in vitro

GSH-activated T₁-weighted MRI