Background

Sonic hedgehog (Shh) is one of three mammalian hedgehog (Hh) genes [Sonic hedgehog, Desert hedgehog, Indian hedgehog]. Each of the Hh genes encodes a secreted signaling peptide that binds to a membrane bound receptor (Ptc). Binding of Hh ligand to the Ptc receptor on the target cell initiates an intracellular signal transduction cascade that ultimately activates expression of Hh target genes through the activity of a family of Gli transcription factors [1]. Previous studies have identified Shh as an important regulator of prostate development [2–7]. Shh is expressed exclusively in the epithelium of the develo** prostate. Expression is most abundant during prostate ductal budding and postnatal ductal morphogenesis and diminishes to a low level in the adult. Ihh is also expressed in the prostate epithelium. It is expressed at relatively lower levels in the develo** prostate but in a distinctive pattern and, in contrast to Shh, its expression is maintained undiminished in the adult [8]. Shh expressed by the Urogenital Sinus (UGS) epithelium induces mesenchymal Hh target gene expression indicating a paracrine mechanism of action [2–5, 7]. Paracrine signaling directly affects mesenchymal proliferation [3, 7], but also influence epithelial proliferation and differentiation by paracrine feedback mechanisms [[4, 7, 9], manuscript in preparation]. Autocrine or juxtacrine signaling is a prominent feature of Hh actions in development [1] and several lines of evidence now suggest that autocrine signaling stimulates prostate epithelial proliferation [6, 10].

Recently Hh signaling has been identified as an important factor in prostate cancer. Paracrine signaling from tumor cells has been shown to activate Hh target gene expression in the adjacent stroma and xenograft studies indicate that paracrine signaling can accelerate tumor growth [9]. In addition, evidence has been presented suggesting that autocrine signaling may also occur, particularly in advanced prostate cancer, and directly drive tumor cell proliferation [11–18]. Quantitative RT-PCR and immunohistochemical staining showed no change in the expression of FoxA2 (data not shown). Quantitative RT-PCR showed diminished FoxA1 mRNA expression that contrasted with increased staining for FoxA1 protein in the LADY tumor (Fig. 4). Expression of the differentiation markers Npdc-1 and probasin were significantly decreased in the tumor, suggesting an inhibition of luminal cell differentiation.

Figure 3
figure 3

Proliferation and associated gene expression in control CD-1 and LADY CG. 3A: Panels A and B: Ki67 staining in six and 16 week CG was limited to a few scattered epithelial cells (A, arrow; B, arrowheads). Panels C and D: Greater than 50% of epithelial cells stained positive for Ki67. 3B: Proliferation associated gene expression changes at six and 16 weeks in control CD-1 and LADY CG. Panel A: Notch1, B: Nestin. 3C: Nestin staining at six and 16 week in Control and LADY CG Panels A and B: Little to no staining at six weeks with a few cells detected at 16 weeks in control CD-1 CG (Arrow = basal-like cell). Panels C and D: Increased nestin expression is observed in 16 week prostate tumor. Asteric = epithelial cells.

Full size image
Figure 4
figure 4

Differention associated gene expression changes in LADY tumor development. 4A: Differentiation gene expression analysis in control CD-1 and LADY CG at six6 and 16 weeks of age A: Probasin, B: NPDC-1, C: FoxA1. 4B: Foxa1 staining in Control and LADY CG. Panels A and B: FoxA1 protein is detected in the epithelial cells of six and 16 week CG. Panels C and D: Dysplastic epithelial cells continue to express high levels of Foxa1, asteric denotes areas of normal prostatic tissue.

Full size image

Discussion

Several groups have examined the expression of Hh ligands and Hh signaling activity in human prostate cancer with inconsistent findings. We first reported that robust Shh expression and Gli1 expression was characteristic of both the normal adult human prostate as well as benign prostatic hyperplasia and prostate cancer [9]. Karhadkar [11] reported that Shh and Ihh were both expressed in localized prostate cancer and benign tissue but that the Hh target genes Ptc and Gli1 were expressed only in metastatic tumors. Sanchez et al [12] reported findings suggesting a basal level of Shh, Ptc and Gli1 expression in benign tissue that is variably increased in cancer while Sheng et al [4]. In contrast, lower level Ihh expression is maintained at a fairly constant level throughout development and in adulthood [8]. We have observed two other circumstances where prostate Ihh expression is increased. The first is during prostate development in the Shh transgenic null, where Hh signaling is maintained by a significant increase in Ihh expression [8]. The second is during castration-induced involution of the VP, where there is a marked increase in Ihh expression without a comparable increase in Shh expression (unpublished observations). Taken together, these findings suggest that Shh and Ihh are differentially regulated and, while exhibiting some degree of functionally redundancy, may normally play different roles in prostate growth regulation. Indeed, studies of Hh signaling in prostate development suggest that Hh signaling exerts a variety of effects, including stimulation of progenitor cell proliferation, regulating ductal epithelial proliferation and differentiation and ductal morphogenesis through a combination of autocrine and paracrine signaling [19]. The respective roles of Shh and Ihh in these effects remains to be elucidated, but we have been intrigued to discover that the domain of Ihh expression coincides with the regions where tissue specific stem cells appear to be present in relative abundance [21]. FoxA1 immunoreactivity is found in epithelial cells of both the develo** and adult prostate [21]. We found that mRNA levels deceased significantly in the LADY tumor but that staining for FoxA1 protein was undiminished. Possible mechanisms for these findings would include increased rates of mRNA turnover or stabilization of FoxA1 protein stabilization in cells that do not udergo terminal differention. FoxA2 expression is prominent in develo** bud epithelium during prostate development but localizes to basal epithelial cells of the adult periurethral ducts [21]. FoxA2 has been detected in neuroendocrine small cell carcinomas and high Gleason grade adenocarcinomas [18], but FoxA2 mRNA expression was not increased in the LADY tumors,

Conclusion

There is no net increase in Hh signaling during tumor development in the LADY prostate cancer model. However, there is a selective and marked increase in Ihh expression even as Shh expression is decreased. Tumor development is associated with increased epithelial proliferation, increased expression on progenitor cell markers and decreased expression of terminal differentiation markers. Ihh expression may be associated with a progenitor cell population that is expanded during tumor development.

Methods

Animals

LADY mice, strain 12T-7f in a CD-1 background, were used for this study. Animals were bred, raised and sacrificed according to University of Wisconsin animal care and use guidelines. Prostate specific lobes were harvested at various times and either fixed in 10% formalin for sectioning or flash frozen for RNA isolation.

RNA isolation and Real Time-PCR

RNA was isolated using Qiagen RNeasy kit with on column DNase treatment as per manufacturer's directions. Following reverse transcription by standard protocols, gene expression was quantitated by real time PCR using Power SYBR Green PCR master mix (Applied Biosystems) on a BioRad iCycler. Expression was normalized to the internal control gene glyceraldehydes-3-phosphate dehydrogenase (GAPDH) for each gene assayed. Gene specific primer sequences are as follows:GAPDH: 5'-AGCCTCGTCCCGTAGACAAAAT-3' and 5'-CCGTGAGTG GAGTCATACTGGA-3', Shh: 5'-AATGCC TTGGCCATCTCTGT-3' and 5'GCTCGACCCTCATAGTGTAGAGACT-3', Ihh: 5'-CAGCTCACCCCCAACTACAA-3' and 5'-GAGCTCACCCCCAACTACAA-3', Ptc1: 5'-CTCTGGAGCAGATTTCCAAGG-3' and 5'-TGCCGCAGTTCTTTTGAATG-3', Gli1: 5'-GGAAGTCCTATTCACGCCTTGA-3' and 5'CAACCTTCTTGCTCACACATG TAAG-3', Igfbp-6: 5'-AGCTCCAGACTGAGGTCTTCC-3' and 5'-GAACGACACTGCTGCTTGC-3', P21: 5'-TTGCACTCTGGTGTCTGAGC-3' and 5'-TCTGCGCTTGGAGTGATAGA-3', Notch1: 5'-ACCCACTCTGTCTCCCACAC-3' and 5'-GCTTCCTTGCTACCACAAGC'-3', Nestin: 5'-GGACAGGACCAAGAGGAACA-3' and 5'-TCTGGATCCACCTTTTCTGG-3', Probasin: 5'-TCATCCTCCTGCTCACACTG-3' and 5'-AAGGCCCGTCAATCTTCTTT-3', NPDC-1: 5'-CCTCCGATGAGGAAAATGAA-3' and 5'-CGTGGAATGGTCAAACAGTG-3', FoxA1: 5'-CTCCTTATGGCGCTACCTTG-3' and 5'-AGCACGGGTCTGGAATACAC-3'.

Immunohistochemical analysis

Tissues were fixed in 10% buffered formalin overnight, followed by transfer to 50% alcohol. The paraffin-embedded tissues were sectioned (5 μm). Sections were deparaffinized and rehydrated in ethanol solutions. For FoxA1 (goat anti-FoxA1, Santa Cruz) staining, after antigen unmasking by boiling in 10 mM sodium citrate buffer (pH 6.0) for 20 min, the sections were treated with 3% hydrogen peroxide for 5 min. The following detection and visualization procedures were performed according to manufacturer's protocol (Vector Laboratories). For Ki67 staining was done at Vanderbilt Immunohistochemistry Core/Lab, the sections were rehydrated and placed in heated Target Retrieval Solution (Labvision, Fremont, CA) for 20 min. Endogenous peroxidase was neutralized with 0.03% hydrogen peroxide followed by a casein-based protein block (DakoCytomation, Carpinteria, CA) to minimize nonspecific staining. The sections were incubated with rabbit anti- Ki-67 (Vector Laboratories, Burlingame, CA) for 30 min. The Dako Envision+ HRP/DAB System (DakoCytomation) was used to produce localized, visible staining. Negative control slides were performed without primary antibodies.

Statistical Methods

Two-Way Analysis of Variance (ANOVA) was used to compare expression levels as a function of age (six vs. 16 weeks), LADY gene [(-) vs (+)] and their interaction. This was done separately for each of the proteins (Shh, Ihh, Gli 1, Ptc 1, probasin, p21, nestin, NPDC-1, IGFBP-6). The tenability of the assumptions of ANOVA was assessed with residual plots. If the assumptions of ANOVA seemed to be violated, transformations of the response were considered. If a term in the model was statistically significant, pair-wise comparisons were obtained and examined for significance; this corresponds to Fisher's protected Least Significant Difference (LSD) procedure. P < 0.05 was the criterion for statistical significance. The analyses were performed with Proc GLM, SAS v.9.1 statistical software (SAS, Cary, NC). Results: The natural logarithms of the expression levels were log-transformed prior to ANOVA in order to homogenize the variances and better meet the assumptions of ANOVA.