Introduction

Mutations in the X-linked gene MECP2, which encodes methyl-binding protein 2 (MeCP2), are the major causes of neurodevelopmental disorder Rett syndrome (RTT) occurred mainly in girls1. RTT patients show severe neurological phenotypes such as mental retardation, functional loss in language, autistic features and motor defects2. Several mouse models with Mecp2 depletion have been established and used as powerful tools to explore the relationship between MeCP2 and Rett syndrome, as Mecp2-null mice display phenotypes similar to RTT patients3,4. Previous studies have shown that pathogenesis of RTT mainly attributed to MeCP2 dysfunctions in the nervous system, which highlights the essential role of MeCP2 for neuronal development and functions5,6,7,8. Recently, plenty of studies have investigated the critical roles of MeCP2 in different types of neurons and different cell types of the brain6,9,10,11,12,13; however, the molecular mechanisms for MeCP2 to exert its functions in different cell types remain largely unknown.

MeCP2 was initially identified as a protein showing high affinity to methylated CpG islands14,15 and further studies revealed that it served as a transcriptional repressor by binding to highly methylated genomic regions16. It was also shown that MeCP2 could interact with several transcriptional repressor complexes such as HDAC-mSin3A and NCoR-SMRT complex to repress gene transcription16,17,18. Although it has been confirmed that MeCP2 could repress gene expression in neurons by many studies19, studies in Mecp2-null mice showed that about 70% genes were down-regulated and this may be due to MeCP2 interaction with CREB to stimulate gene expression20. What’s more, it was revealed that MeCP2 could bind to DNA regions containing high level of 5-hydroxymethylcytosine (5 hmC) to promote gene expression21. Therefore MeCP2 was considered as a transcriptional modulator to regulate gene expression bi-directionally. In addition, studies also showed that MeCP2 was involved in the regulation of microRNA expression10,22,23, and MeCP2 could interact with Drosha/DGCR8 complex and other factors to modulate microRNA processing24,25. Subsequent studies demonstrated that MeCP2 could also interact with splicing factors such as Y-box-binding protein 1 (YB-1) to regulate RNA splicing process26,27. And aberrant RNA splicing events were detected in Mecp2308/Y mice that express a truncated MeCP2 protein and recapitulate multiple clinical features of RTT patients26. Recent studies in non-neuronal cell lines IMR90 and HCT116 confirmed the involvement of MeCP2 in regulating alternative splicing, by showing that MeCP2 was enriched in included alternative splicing exons (ASEs) with highly methylated status, and MeCP2 knockdown led to dysregulated alternative splicing in these cell lines28.

Alternative splicing is a critical post-transcriptional process, which produces divergent mRNA isoforms from a single primary transcript to generate proteins with distinct functions or to modulate protein expression levels via the nonsense-mediated mRNA decay pathway (NMD)29,30. High-throughput studies showed that alternative splicing process was particularly more common and conserved in the central nervous system as compared to other tissues, and the precise regulation of alternative splicing was critical for divergent aspects of neuronal development via modulation of protein diversity and abundance31,32,33,34,35.

It was well-established that splicing factors were mainly RNA-binding proteins which regulated alternative splicing at RNA level36. Mutations in RNA splicing factors and aberrant alternative splicing have been implicated in various neurological diseases such as amyotrophic lateral sclerosis (ALS), autistic spectrum disorders (ASD) and Rett syndrome26,35,37,Supplementary Table 4). In addition, significant functional enrichment was also observed in intracellular transport, RNA processing, chromatin organization (Fig. 4b). These results suggested that MeCP2-mediated alternative splicing was important for normal neuronal functions and likely involved in epigenetic or post-transcriptionally regulation.

Figure 4: Functional annotations for genes containing MeCP2-regulated exons.
figure 4

(a) Radar chart for GO analysis of the genes containing MeCP2-regulated exons identified in mouse cortical neurons. (b) GO analysis for the genes containing MeCP2-regulated exons. (c) Pie chart of the exon classifications for MeCP2-regulated exons based on the exon’s coding ability. (d) GO analysis for the genes containing MeCP2-regulated coding exons and for the genes containing MeCP2-regulated non-coding exons, respectively.

Full size image

Exons were further annotated according to protein-coding ability of related transcripts and divided into coding exons which was in the transcripts of protein-coding mRNAs or non-coding exons only in non-coding transcripts including non-mediated decay or processed transcripts. It was speculated that changes of coding exons usage may influence protein diversity while non-coding exons might be involved in the regulation of translation and protein expression, so MeCP2-regulated exons were further classified into these two classes for functional analysis. It was shown that exons down-regulated in MeCP2-knockdown neurons were mainly coding exons (559/608) while a large fraction of non-coding exons were up-regulated (413/462) (Fig. 4c). GO functional analysis showed that non-coding exons were mainly enriched in functions associated with chromatin and RNA regulation such as RNA processing, chromatin modification and chromatin organization; while coding exons were enriched in neuronal physiological functions such as intracellular transport and synapse organization (Fig. 4d). These results indicated that MeCP2-mediated RNA splicing had divergent functional consequences, further confirming the multifaceted functions of MeCP2.

Discussion

Several studies confirmed the involvement of MeCP2 in regulating alternative splicing and provided insights into the underlying mechanisms, by showing that MeCP2 may modulate alternative splicing through its interaction with both splicing factors and epigenetic markers such as 5 mC26,28,51. However, comprehensive analysis for the role of MeCP2 in alternative splicing in neurons remained elusive. Here we explored the potential mechanisms underlying MeCP2-mediated alternative splicing at protein, RNA and DNA level in neurons using mass spectrum, RNA-Seq and ChIP-Seq data re-analysis. Our results showed that MeCP2 depletion in cultured cortical neurons led to significant splicing changes by RNA-Seq, confirming the critical role of MeCP2 in alternative splicing regulation. Mass spectrum for MeCP2-binding proteins showed that MeCP2 could interact with transcriptional regulators, splicing factors and chromatin-related modifiers (Supplementary Fig. 3), which suggested that MeCP2 might serve as a bridge for chromatin-related modifiers and splicing factors to modulate alternative splicing. Moreover, ChIP-Seq data re-analysis for MeCP2, 5 mC and 5 hmC revealed that MeCP2 distribution in down-regulated exons of Mecp2-knockdown neurons was positively correlated with 5 hmC but not 5 mC, which is not in consistent with studies in non-neuronal cell lines IMR90 and HCT11628. This inconsistency might reflect that MeCP2 functions varied depending on cell types, and is consistent with previous studies showing that the role of 5 hmC in alternative splicing regulation was tissue specific46. We further analyzed ChIP-Seq data for Pol II and confirmed that MeCP2-mediated alternative splicing might be coupled to Pol II-regulated transcriptional elongation28. Pol II distribution analysis in this study also confirmed the reliability of our ChIP-data re-analysis. We then further examined the ChIP-Seq data for H3K4me3 and H3K36me3, which has been implicated in the regulation of exon inclusion and exon skip** respectively, and revealed that H3K4me3 was highly enriched in down-regulated exons while H3K36me3 was enriched in up-regulated exons of Mecp2-knockdown neurons. As MeCP2 was enriched in down-regulated exons and MeCP2 could interact with CHD1 and PARP1 (Supplementary Fig. 3), which were H3K4me3-related proteins, it is possible that MeCP2 might be involved in H3K4me3-mediated exon inclusion. Taken together, MeCP2 might serve as a scaffold protein for alternative splicing, by “translating” epigenetic modifications into signals to guide splicing factors for splicing regulation.

In addition to investigations about mechanisms underlying MeCP2-mediated alternative splicing, we also examined the functional enrichment of genes containing MeCP2-regulated exons in cultured cortical neurons. It was shown that MeCP2-mediated alternative splicing was highly enriched in two major functional classes: one is associated with neuronal physiological functions such as intracellular transport, axon cargo transport and synaptic organization while another is closely related to chromatin and RNA regulation such as chromatin structure, RNA processing and splicing. We noticed that according to the protein-coding ability, exons could be further divided into coding exons and non-coding exons, and functional enrichment reanalysis for coding and non-coding exons regulated by MeCP2 showed that coding exons mainly enriched in neuronal physiological functions while non-coding exons mainly enriched in chromatin and RNA regulatory functions.

Moreover, we further found that most of the MeCP2-regulated non-coding exons were up-regulated in MeCP2-knockdown neurons (413/462). As non-coding exons might inhibit gene expression via protein translational regulation, it is possible that in normal neurons, MeCP2 inhibited the inclusion of non-coding exons to promote gene expression while Mecp2 knockdown led to repression of gene expression at protein level. Our analysis thus indicated that MeCP2-mediated alternative splicing might influence neuronal functions via two different strategies: one is to regulate protein diversity by coding exons, and another is to regulate protein expression by non-coding exons. Our studies not only systematically explore the mechanisms underlying MeCP2-mediated alternative splicing, but also provide insights into the roles of MeCP2-mediated alternative splicing, which could influence both protein diversity and protein expression level in neurons.

Materials and Methods

Ethical approval and informed consent

The experimental protocol and procedures followed the guidelines and regulations issued by SIBS, CAS and were approved by Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

Mecp2 knockdown in neurons

The shRNA specifically against mouse Mecp2 and related lentivirus preparation has been described previously24. Briefly, embryonic day 15–16 mouse cortical cells were isolated and cultured in 6-well plates. Lentivirus expressing either shRNA against mouse Mecp2 or control shRNA was added at day in vitro (DIV) 2, and neurons were cultured for another 3–5 days. Total RNAs/proteins were collected for further analysis.

Generation of Mecp2-null rat

Mecp2-null rat was generated by transcription activator-like effector nucleases (TALENs)-mediated gene targeting. In brief, TALENs mRNAs specifically targeting against exon2 of the rat Mecp2 gene were designed, tested and prepared by the Bei**g Biocytogen Co. Ltd. Rat zygotes were injected with Mecp2 TALENs mRNAs and were then implanted into surrogate rat mothers. Mecp2 locus was determined in F0 rats by PCR and sanger sequencing and rats carrying disrupted Mecp2 genome locus were chosen for F1 preparation. MeCP2 expression in F1 rats was determined by western blot. Mecp2-null rats and wild-type (WT) littermates were used for subsequent experiments.

Purification of MeCP2 protein complexes

MeCP2 protein complexes were purified as described previously52. Briefly, His-MeCP2 expression plasmid was transfected into 293 T cells and purified by Ni-NTA His binding resin (Millipore, Bedford, MA, USA) was used to purify overexpressed His-MeCP2 in 293-T cells, and after washing extensively for four times with Urea buffer, mass spectrometry was performed to identify the proteins closely associated with MeCP2.

Immunoprecipitation in cultured mouse cortical neurons and in rat cortex

As described previously52, cultured mouse cortical neurons were collected and lysed in RIPA buffer and MeCP2 antibody (Cell signaling technology, Beverly, MA, USA) was used for protein immunoprecipitation and normal rabbit IgG (Santa Cruz, CA, USA) was used as negative control.

Immunoprecipitation in rat cortex was performed as following: Mecp2-null rat cortex and WT littermate cortex were collected and lysed with RIPA buffer, and were purified by Ni-NTA His binding resin (Millipore, Bedford, MA, USA) due to the tandem Histidine residues in the MeCP2 protein.

Trypsin digestion

The purified protein was suspended and reduced in 50 μl lysis buffer (7 M urea, 2 M thiourea, 10 mM HEPES, 1 mM sodium orthoranadate, 5 mM sodium fluoride, 5 mM β-glycerophosphate, 10 mM DTT, pH 8.0, then alkylated with 50 mM iodoacetamide. After reducing urea concentration to 2 M, the samples were digested with trypsin (Promega, USA) at 37 °C (1:100 w/w) overnight. The digested peptide mixtures were acidified with trifluoroacetic acid (TFA) at 1% final concentration and desalted by reversed-phase C18 Sep-Pak cartridge (Millipore, USA).

Mass spectrometry analysis

Peptides were loaded and separated on an EASY-nLC1000 LC (Thermo Scientific) coupled on line to the Q-Exactive Orbitrap mass spectrometer (Thermo Scientific). The microcapillary trap column was constructed in a 25 mm × 75 silica capillary, packed with 5-μm Luna C18 stationary phase (Phenomenex). The analytical column was constructed in a 150 mm × 75 μm silica capillary tip pulled with a column puller and packed with 3-μm Luna C18 stationary phase. The organic gradient was over 120 min using buffers A and B. Buffer A contained 2% acetonitrile with 0.1% acetic acid. Buffer B contained 98% acetonitrile with 0.1% acetic acid. The separation was performed in 90 min at a flow rate of 300 nl/min, with a gradient of 2% to 6% buffer B in 1 min, followed by 6% to 24% in 61 min, 24% to 100% in 14 min, then 100% buffer B for 5 min and 100% to 0% in 1 min and finally 0% buffer B in 8 min. Full MS were acquired at a resolution of 70,000 with an AGC target value of 3 × 106 and a maximum injection time of 100 ms. Target value for the MS/MS scans was 1 × 105 charges with a resolution of 17,500 and a maximum injection time of 50 ms. The raw files were analyzed by MaxQuant software (version 1.5.3.8) against the latest release of the human, mouse or rat Uniprot database respectively (http://www.uniprot.org/proteomes/).

RNA-Seq

Hippocampal tissue from Mecp2-null rats or wild-type rats at postnatal 30 days and neurons infected with lentivirus expressing either shRNA against mouse Mecp2 or control shRNA were prepared in biological triplicate and total RNA was isolated by TRIzol reagent (Invitrogen). Then RNase-free DNaseI was used to remove potential genomic DNA contamination and polyA + mRNA was isolated using Dynabeads oligo(dT) for cDNA preparation. Superscript II reverse transcriptase (Invitrogen) and random hexamer primers were used for double-stranded cDNA synthesis. Then mRNA-seq libraries for mouse neurons were established according to the standard Illumina protocol. RNA-seq was performed using Illumina Hiseq 2000 > 45 million 2 × 100 reads per sample was produced and alignment was performed using mouse genome database GRCm38 version 67. Raw data for RNA-seq was submitted to NCBI GEO database #79993. Complementary DNA (cDNA) libraries of rat hippocampus for single-end sequencing were prepared using Ion Total RNA-Seq Kit v2.0 (Life Technologies) according to the manufacturer’s instructions. The cDNA libraries were then processed for the Proton Sequencing process according to the commercially available protocols. Samples were diluted and mixed, the mixture was processed on a OneTouch 2 instrument (Life Technologies) and enriched on a OneTouch 2 ES station (Life Technologies) for preparing the template-positive Ion PI™ Ion Sphere™ Particles (Life Technologies) according to Ion PI™ Template OT2 200 Kit v2.0 (Life Technologies). After enrichment, the mixed template-positive Ion PI™ Ion Sphere™ Particles of samples was loaded on to 1 P1v2 Proton Chip (Life Technologies) and sequenced on Proton Sequencers according to Ion PI Sequencing 200 Kit v2.0 (Life Technologies).

Quantitative Real-Time PCR

Quantitative real-time PCR assay was performed as described previously. Briefly, total RNA was isolated by TRIzol reagent (Invitrogen) and then converted to cDNA using 5XPrimeScript RT Master Mix (TAKARA). SYBR Premix from Toyobo was used with Rotor-Gene Q machine (QIANGEN). Data was analyzed with comparative CT method. Primers used in this study were as follows:

Gria1-005 for: ACATTGAGCAACGCAAGC;

Gria1-005 rev: CCCTGCTCGTTCAGTTTTAAC;

Gria1 for (internal control): GTCCGCCCTGAGAAATCCAG;

Gria1 rev (internal control): CTCGCCCTTGTCGTACCAC;

Nrxn1 for (internal control): CGGAGACCCCAGTCCTATGG;

Nrxn1 rev (internal control): AACATCATCGGATGCAAATGGA;

Nrxn1-024 for: AGGCATTGGACACGCTATG;

Nrxn1-024 rev: TTACTGACTGGTGACCCTGG;

Nrxn1-027 for: TGCCAAAACTGGTCCATGC;

Nrxn1-027 rev: GCAAGTCAGCTTTCATCAATGC;

Gabrg2-027 for: CTTTGGTGGAGTATGGCAC;

Gabrg2-027 rev: AAGGAAAACATCCGAAGAAGAG;

Gabrg2 for (internal control): CAGACTTACATTCCCTGCAC;

Gabrg2 rev (internal control): CTTGGGCAGAGATTTTCTGG;

Camta1 for (internal control): CTATGTCCATTCCTCCATCATAC;

Camta1 rev (internal control): TAGCCCACTCCTTCTTGTC;

Camta1-013 for: CCGAAAAAGCTGCTTGAATGTC;

Camta1-013 rev: AAGGTAATGCAGGTCAGGGG;

Camta1-001 for: AGCGTTTCCCAAAGTGTATTC;

Camta1-001 rev: ACTTGAACATTTCGGCAGAC;

Rcan1-201 for: ACAATTTTAGCTCCCTGATTGC;

Rcan1-201 rev: GCTCTTAAAATACTGGAAGGTGG;

Rcan1 for (internal control): AAACTTCAGCAACCCCTTATC;

Rcan1 rev (internal control): CAGGTGTGAACTTCCTATGTG;

Top3b-intron for: GAAAGGAACACCGTACAGC;

Top3b-intron rev: TCACAACTAGGAATAGGATAGGG;

Top3b for (internal control): GTGCTCATGGTAGCAGAAAAG;

Top3b rev (internal control): GCAAAGGTTCCTGTGTACTTG.

Exon usage analysis

Alternative spliced exons RNA-Seq reads were aligned to the mouse genome by the company, and bam files were obtained. We used the DEXSeq package53 in Bioconductor to identify significantly differentially regulated exons in MeCP2 knockdown neurons based on these bam files, according to Version 67 of the ensemble annotation GTF file for mouse. Exons with a p-value less than or equal to 0.05 after multi-test correction were considered significantly differentially regulated. Significantly downregulated exons were considered as “inclusive” exons, while significantly up-regulated exons were “exclusive” exons.

Alternative Splicing Detection

We selected the Alternative Splicing Detector (ASD, available on http://www.novelbio.com/asd/ASD.html) as the tool to detect the differentially alternative splicing cases based on the bam file after map** according to the P-Value threshold (P-Value < 0.05)47.

ChIP-Seq data analysis

ChIP-Seq data in BigWig format for MeCP2 binding sites in cultured embryonic mouse cortical neurons were downloaded from the GEO database (GSE3185154). ChIP-Seq data in BigWig format for PolII binding and histone markers in embryonic mouse cortical neurons were downloaded from the GEO database (GSE2116155). DNA methylation data (5mc and 5hmc) and ChIP-Seq data for histone markers in BigWig format in embryonic mouse cortex neurons were downloaded from the GEO database (GSE3811856). The BigWig files were then transformed to bedgraph format, and narrow peaks were called by using MACS57. The generated peak regions for PolII, histone markers and DNA methylation were then mapped to the regions of the exclusive exons and the inclusive exons. Each exon region was extended as the length of the exon region to both the upstream and the downstream of the exon, and were also mapped with the generated peak regions. Results for all the exclusive exons and all the inclusive exons were combined together to draw figured to display the epigenetic dynamics in and around these exons. A sliding window of 10 bp was used to draw each point. The same was applied to all exons used in this analysis as the background. KS test and T test were used to examine whether there was a significant different among the distributions of each histone marker/Methylation type/Pol II binding in exclusive exons, inclusive exons and all background exons used in this analysis.

Functional enrichment analysis

Genes containing exclusive exons and inclusive exons were obtained. Functional enrichment analysis was applied to these genes by using the online server DAVID (https://david.ncifcrf.gov).

Exon annotations

Exons were annotated according to ensemble annotation file using DEXSeq. Then these exons were compared with protein-coding exons annotated in ensemble database. Those showing no overlap with protein-coding exons were classified as non-coding exons.

Comparison between genes containing MeCP2-regulated exons and functional gene list

The overlap of genes containing MeCP2-regulated exons with different functional gene lists was analyzed as described previously58. In brief, gene lists of postsynaptic proteome, NMDAR complex, mGluR5 complex, AMPAR complex and synaptome were downloaded from http://www.genes2cognition.org/, the pre-synaptic proteome has been described in Croning et al., Table S459. Gene list for autism spectrum disorders was from Simons SFARI Gene database60. Statistical analysis for overlap between genes containing MeCP2-regulated exons and different gene lists was determined by Fisher’s exact test.

Additional Information

How to cite this article: Cheng, T.-L. et al. Regulation of mRNA splicing by MeCP2 via epigenetic modifications in the brain. Sci. Rep. 7, 42790; doi: 10.1038/srep42790 (2017).

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.