Abstract
Elevated impulsivity is a key component of attention-deficit hyperactivity disorder (ADHD), bipolar disorder and juvenile myoclonic epilepsy (JME). We performed a genome-wide association, colocalization, polygenic risk score, and pathway analysis of impulsivity in JME (n = 381). Results were followed up with functional characterisation using a drosophila model. We identified genome-wide associated SNPs at 8q13.3 (P = 7.5 × 10−9) and 10p11.21 (P = 3.6 × 10−8). The 8q13.3 locus colocalizes with SLCO5A1 expression quantitative trait loci in cerebral cortex (P = 9.5 × 10−3). SLCO5A1 codes for an organic anion transporter and upregulates synapse assembly/organisation genes. Pathway analysis demonstrates 12.7-fold enrichment for presynaptic membrane assembly genes (P = 0.0005) and 14.3-fold enrichment for presynaptic organisation genes (P = 0.0005) including NLGN1 and PTPRD. RNAi knockdown of Oatp30B, the Drosophila polypeptide with the highest homology to SLCO5A1, causes over-reactive startling behaviour (P = 8.7 × 10−3) and increased seizure-like events (P = 6.8 × 10−7). Polygenic risk score for ADHD genetically correlates with impulsivity scores in JME (P = 1.60 × 10−3). SLCO5A1 loss-of-function represents an impulsivity and seizure mechanism. Synaptic assembly genes may inform the aetiology of impulsivity in health and disease.
Similar content being viewed by others
Introduction
Impulsivity is a heritable behavioural trait leading to actions that are “poorly conceived, prematurely expressed, unduly risky, or inappropriate to the situation and that often result in undesirable consequences”1. Estimates of heritability for impulsivity from a study of twins were between 33% and 56% at ages 11–13 years, and between 19% and 44% at ages 14–162. Raised impulsivity is a key endophenotype of attention-deficit hyperactivity disorder (ADHD)3, bipolar disorder4 and juvenile myoclonic epilepsy (JME)5,6,7. ADHD is characterised by inattention, hyperactivity and impulsivity. Individuals with ADHD show more signs of impulsivity (attentional, non-planning and motor) compared to controls8. A previous genome-wide association study (GWAS) of impulsive personality traits (UPPS-P Sensation Seeking, Drug Experimentation and UPPS-P Negative Urgency) in 22,861 healthy individuals of European ancestry demonstrated two significant associated loci at 3p12.1 and 22q13.19. Variants at the 3p12.1 locus correlated with predicted Cell Adhesion Molecule–2 (CADM2) expression, in the putamen10, and the 22q13.1 locus near CACNA1I has been previously implicated in schizophrenia11. CADM2 mediates synaptic signalling and is highly expressed in the human cerebral cortex and cerebellum12. Given impulsivity is elevated in neuropsychiatric disorders, there may be shared genetic mechanisms across disorders and/or with impulsivity in the general population, however to our knowledge there has been no GWAS of impulsivity in any neuropsychiatric disorder.
Impulsivity is elevated in different epilepsies, but the evidence across multiple dimensions of impulsivity is strongest in JME5,6,7. JME is a common adolescent-onset syndrome characterised by awakening myoclonic, generalised tonic-clonic and absence seizures, often triggered by sleep deprivation. Trait impulsivity in JME is associated with the frequency of both myoclonic and absence seizures6, but it is not clear if this indicates a causal relationship or a common mechanism regulating both impulsivity and seizures, though convergent lines of evidence suggest the involvement of overlap** prefrontal-striatal networks in both JME and impulsivity13,14,15,16,17,18,19,20. Finding a shared aetiology would offer new therapeutic approaches for drug-resistant epilepsy.
The overall syndrome of JME has complex inheritance with few replicated susceptibility loci21,22, and other loci with less support22,23,24. A major challenge for epilepsies of complex inheritance is to explain the wide variation in phenotypic expression and treatment response between individuals. Forty-percent experience antiseizure medication (ASM) resistance or intolerance25. In addition, no current ASM modifies the lifelong disease course of JME and the pharmacological options are sparse, especially for women25. Hence novel treatments based on genetic disease mechanisms, such as those emerging for monogenic channelopathy and mTOR pathway epilepsies, are urgently needed26,27. Our methodological approach is to carry out genome-wide analysis of endophenotypes in JME such as impulsivity and clinically relevant outcomes such as ASM resistance, a strategy with predicted advantages for reducing heterogeneity, increasing statistical power28,29 and improving direct clinical translation for precision medicine.
Results
Genome-wide association analysis with BIS-Brief
We investigated the influence of 8,950,360 variants on impulsivity in European ancestry patients with JME (n = 324) and a mega-analysis including all ancestries (n = 372), who self-rated their trait impulsivity using the Barratt Impulsivity Scale, eight-item BIS-Brief version30. We conducted a GWAS of BIS-Brief score (Supplementary Fig. 2) in the European subset, adjusted for sex, genoty** batch, age at consent, population stratification, and seizure frequency (Supplementary Table 2). We discovered two genome-wide significant loci, one on chromosome 8 (rs73293634 (G/T)) and one on chromosome 10 (rs75042057 (T/G) (Fig. 1, Table 1, Supplementary Figs. 3 and 4). Given the distribution of BIS-Brief was slightly right skewed, for sensitivity analysis we tested the SNP associations using an inverse rank normal transformed BIS-Brief phenotype as well. Qualitatively similar results were obtained with rs73293634 and rs75042057 demonstrating association with p = 3.1 × 10−8 and p = 1.4 × 10−7, respectively (Supplementary Table 3). The distribution of BIS-Brief by rs73293634 and rs75042057 genotypes are provided in Supplementary Fig. 5. In a mega-analysis comprised of all ancestral groups (Supplementary Fig. 6), these loci were further supported including by a nearby chromosome 8 SNP (rs146866040, r2 = 0.89) with stronger evidence of association in the combined ancestry mega-analysis as measured by the p value (P = 1.57 × 10−9; Table 1), providing cross-ancestral support for the locus.
rs73293634 falls in an intergenic region near SLCO5A1. The phenotypic variation explained (PVE) for rs73293634 was 10.1% in the European analysis. Although a second JME cohort with impulsivity measured is not available for replication, Watanabe et al. 31 reported a rs73293634 association with risk taking in the UK Biobank, where they asked the question “Would you describe yourself as someone who takes risks?” (OR (95% CI) = 1.032 (1.001–1.065), p = 0.04, minor allele frequency (MAF) = 0.03, N = 371,049). Association results posted on the same data by the Neale Lab32 with ~23 K fewer participants, provides a similar qualitative conclusion (β (SE) = 0.005 (0.003), p = 0.09, MAF = 0.03, N = 348,549). Two individuals with large structural deletions that include SLCO5A1 are reported in the Decipher Genomics database with seizures and neurodevelopmental disorder (www.deciphergenomics.org/gene/SLCO5A1/patient-overlap/cnvs).
The significant genome-wide association on chromosome 10 (rs75042057) falls in intron 22 of PARD3 (NM_001184785.2). The PVE by the SNP is 9.3%, although there are no variants in linkage disequilibrium with this SNP so further interrogation and confirmation of this locus is required. We note, however, that significant linkage (multipoint max LOD 4.23, alpha 0.34) was previously reported to this locus in French-Canadian families with idiopathic generalised epilepsy (IGE)33, of which JME is a common subtype. As well, rs75042057 was also associated with risk-taking in the UK Biobank (OR (95% CI) = 1.067 (1.029–1.106), p = 4.79E-4, MAF = 0.02, N = 371,049)31.
Colocalization analysis with gene expression
Since the GWAS-associated variants are not exonic, we next assessed whether the variants impact gene expression, and for which gene in which tissue of origin, by assessing colocalization of the genome-wide significant peaks with expression quantitative trait loci (eQTL) in brain tissues. We used eQTLs from the Genotype-Tissue Expression project (GTEx) v812, PsychENCODE34, and human fetal brains35 and combined them with the GWAS summary statistics from the mega-analysis, for colocalization analysis adjusting for multiple hypothesis testing36. Colocalization analysis with eQTLs from GTEx brain and tibial nerve tissues for genes at the locus (chr8:69,650,000–70,000,000, hg38) shows significant colocalization with SLCO5A1 in the cerebral cortex, and no colocalization with other genes in the region (Fig. 2a and Supplementary Fig. 7; Simple Sum 2 colocalization P = 9.5 × 10−3). The minor allele for the lead SNP rs73293634 (T) decreases expression in GTEx cerebral cortex (Fig. 2c). We found no significant colocalization with eQTLs from PsychENCODE34 and fetal brains35, although nearby variants in the locus in adult brains in PsychENCODE have, in general, a clear influence on SLCO5A1 expression (Fig. 2b). According to BrainSpan37,38, SLCO5A1 is highly expressed prenatally, with expression drop** after birth but remains detectable throughout adulthood (Fig. 2d). We did not observe significant colocalization at the chromosome 10 locus with eQTLs from adult brains in GTEx12, PsychENCODE34 or fetal brains35.
Functional characterisation of SLCO5A1
SLCO5A1 is a membrane-bound organic anion transporter with no known substrate39 (Fig. 3). We performed a full protein BLAST (BLASTp) search of the SLCO5A1 polypeptide sequence (NP_112220.2) on Drosophila melanogaster to identify the closest matching sequence alignment. While several members of the Oatp family were found to have significant homology, Oatp30B was the family member with the highest homology and a 37.66% identity and E-value of 2 × 10−150 (NP_995667.1). SLCO5A1 was the closest human analogue of Oatp30B also in a reverse BLASTp. Indeed, BLASTp of Oatp30B polypeptide sequence (Q9VLB3) across all species for conserved domains reveals this gene has conserved major facilitator superfamily (MFS), OATP, and Kazal domains (Fig. 3 and Supplementary Fig. 8). We therefore used an effective RNAi transgenic line (Supplementary Fig. 9A) to assess the effect of pan-neuronal adult knockdown of Oatp30B/SLCO5A1. Flies with reduced Oatp30B levels displayed a small but significant shortening of their lifespan (Supplementary Fig. 9B) and a striking over-reaction to vibration stimuli applied through the automated Drosophila Arousal Tracking (DART) system40, which elicit an otherwise modest activity response in two separate control fly genotypes (Fig. 4a). Additional analysis of locomotor behaviour clarifies that Oatp30B knockdown did not alter the speed of flies or the duration of each activity bout or the interval in between bouts of action (Supplementary Fig. 9C–E), indicating a specific defect in excessive response to stimuli. Furthermore, Oatp30B knockdown led to a dramatic increase in the frequency of seizure-like events (Fig. 4b) when exposed to hyperthermia, a trigger for seizures in Drosophila41. Recovery to full motility after seizure-like events was also significantly slower in flies with Oatp30B knockdown (Fig. 4c). These data establish a common causal link between Oatp30B/SLCO5A1 downregulation, startling behaviour, and susceptibility to seizure-like events.
Gene enrichment analyses
We next sought to assess whether there was additional signal in the GWAS where sub-GWAS significant variants could inform additional contributing genes or pathways and whether there were shared genetic contributions with other psychiatric or epilepsy phenotypes. We selected all variants displaying P ≤ 5 × 10−4 and annotated these variants to the transcription start site of the nearest gene resulting in 810 unique genes. Gene enrichment analysis using one-sided hypergeometric tests42 identified a 12.7-fold enrichment of associated genes from the presynaptic membrane organisation gene set (five out of nine genes; gene ontology (GO):0097090) and a 14.3-fold enrichment of associated genes from the presynaptic membrane assembly gene set (five out of eight genes; GO:0097105). These genes were PTEN, NLGN1, PTPRD, IL1RAPL1 and NLGN4X (Table 2). The combined PVE for the lead variants annotated to these five genes was 15.6% (25.8% with the addition of rs73293634 from the SLCO5A1 locus and rs75042057 from the PARD3 locus).
The permutation tests of presynaptic membrane organisation (GO:0097090) over-enrichment and of presynaptic membrane assembly (GO:0097104) over-enrichment both produced permutation-based p values of 0.0005.
Investigation of these 810 genes revealed further43,44,45 that there was a significant overlap with genes reported in the GWAS catalogue that contribute to phenotypes relevant to the predominance of JME seizures on awakening, impulsivity and metabolism: chronotype (66 out of 522 genes overlap, P = 2.92 × 10−12), obesity-related traits (77 out of 662 overlap, P = 2.69 × 10−12), general risk tolerance (30 out of 238 overlap, P = 2.30 × 10−5), and adventurousness (21/134, P = 3.70 × 10−5).
Polygenic risk score analysis
Given impulsivity is a major component of ADHD, risk taking, bipolar disorder and epilepsy, we tested and found that a higher ADHD polygenic risk score (PRS) was significantly associated with a higher BIS-Brief score (p = 1.60 × 10−3) (Supplementary Fig. 10). It should be noted that the lead SLCO5A1 SNP, rs73293634, was not present in the ADHD GWAS from which the PRS was calculated, but rs146866040 which is in high LD did not show evidence of association itself with ADHD (OR (SE) = 0.9481(0.0562), p = 0.34)46. The rs75042057 SNP on Chr10 was also not present in the ADHD dataset nor was there a proxy with R2 > 0.6 available. The risk-taking PRS was also nominally associated with a higher BIS-Brief score (p = 0.018). PRSs for bipolar disorder, generalised and focal epilepsy did not reach statistical significance for association with BIS-Brief score at the 5% or Bonferroni-corrected level of 1% (P = 0.08, 0.33 and 0.96, respectively) (Supplementary Table 4). Altogether this suggests that the impulsive trait seen in JME is an endophenotype that shares genetic architecture with impulsivity in the general population as well as with individuals diagnosed with ADHD.
Discussion
This is a GWAS of trait impulsivity in a neuropsychiatric disorder and we present convergent evidence for the role of SLCO5A1 in impulsivity and seizure susceptibility through triangulation47 with GWAS, independent replication, colocalization with gene expression and functional evaluation in Drosophila48. While several Oatp family members display significant homology to SLCO5A1, the identified Oatp30B was the closest polypeptide in a BLASTp search and SLCO5A1 was the human polypeptide with the highest homology in a reverse BLASTp search. Therefore, whereas our analysis does not rule out some contribution by other closely related Oatp genes, for instance Oatp26F, it has identified a major role of Oatp30B in regulating startling and seizure-like behaviour in Drosophila. In contrast to human SLCO5A1, Oatp30B is expressed in the nervous system at constant low to moderate levels throughout fly stages, from development to adulthood. This enables investigation of gene function in vivo, in adult flies, although it limits generalisation as an SLCO5A1-linked disease model.
One GWAS of impulsive traits in the general population identified genome-wide significant association with variants in the CADM2 gene. CADM2 encodes a cell adhesion protein from the SynCam Immunoglobulin superfamily of recognition molecules, important for synaptic organisation and specificity; association of variants at the CACNA1I locus has been observed in previous studies with schizophrenia9. Our GWAS did not show significant association with these previously reported general population-associated variants at the CADM2 and CACNA1I loci9 (P = 0.152, beta = −0.52 for rs139528938; and P = 0.32, beta = −0.35 for rs4522708; the latter a SNP with r2 = 0.87 with the reported SNP, rs199694726, in our BIS-Brief dataset). Genome-wide summary statistics were not available to make additional comparisons. Genome-wide summary statistics were available for the risk-taking phenotype in the UK Biobank31, in which we observed replication of our lead genome-wide significant SLCO5A1 variant, rs73293634.
Previous expression studies show that SLCO5A1 upregulates gene sets implicated in cell adhesion, synapse assembly and organisation, principally belonging to the cadherin superfamily39; and the enrichment for presynaptic membrane assembly and organisation pathways in our dataset includes genes encoding trans-synaptically interacting proteins that are implicated in a wide range of neuropsychiatric disorders49,Barratt impulsivity scale-brief (BIS-Brief) We collected self-rating of trait impulsivity through the BIS-brief6,30. The BIS-Brief is a short version of the BIS, one of the most commonly used measures of impulsiveness. The current version of BIS (BIS-11) includes 30-items measuring 3 theoretical subtraits: attentional, motor, and non-planning impulsiveness. BIS-Brief is a unidimensional scale including 8 of the original BIS-11 items generating a total score ranging from 8 to 32. BIS-Brief demonstrated similar indices of construct validity observed for the BIS-11 total score. Using BIS-Brief in large epidemiological studies of psychiatric disorders reduces the burden on respondents without loss of information29. DNA was extracted from blood by each consortium site and sent to The Centre for Applied Genomics at The Hospital for Sick Children in Toronto for genoty**. We genotyped participants’ DNA in four batches (n = 702) using the Illumina Omni 2.5 array. SNPs were called using the self-clustering method in Genome Studio. We performed quality control (QC) for each genotyped batch using PLINK v1.90b6.1853 and custom in-house scripts. Briefly, we removed individuals and variants with call rates below 90%; samples with sex mismatches and/or high heterozygosity; males with heterozygous calls for X chromosome markers (non-pseudoautosomal region); and females with non-missing calls for markers on the Y chromosome. We retained heterozygous calls for mitochondrial markers in both sexes (i.e., due to heteroplasmy). We obtained an unrelated sample by using KING v.2.2.4 software’s54 --unrelated option (that is, those with estimated kinship coefficient <0.088). We corrected and updated the ped file with all found relationships, and identified markers with Mendelian errors using PEDSTATS 0.6.1255. We flagged 399 markers but did not remove those out of Hardy–Weinberg Equilibrium (P < 10−4). We conducted principal component analysis adjusted using the kinship matrix output by KING using PC-AiR in the GENESIS v2.16.0 package56. We performed quality control on each genoty** batch separately, followed by removal of ambiguous A/T, G/C SNPs, chr0 SNPs, indels, monomorphic variants, and duplicate variants; and performed strand alignment using Will Rayner’s alignment files (www.well.ox.ac.uk/~wrayner/strand/), then merged all batches. We re-analysed and removed cryptic relationships across batches. The final merged set contained 1,489,917 variants, 695 individuals (241 males, 454 females) including 23 related pairs (for association analyses however, an unrelated set was selected). We used the McCarthy Tools v4.3.0 to prepare the genotype data for imputation (www.well.ox.ac.uk/~wrayner/tools/HRC-1000G-check-bim-v4.3.0.zip) using TOPMed as the reference panel (r2@1.0.0) on the TOPMed imputation server57,58,59. We converted coordinates from hg37 to hg38 coordinates using strand files (www.well.ox.ac.uk/~wrayner/strand/InfiniumOmni2-5-8v1-4_A1-b38-strand.zip). We merged the pseudoautosomal region (PAR) using PLINK’s --merge-x option and checked variants using the HRC checking tool. We removed a total of 282,660 variants due to no matches in the reference (but still analysed for association with BIS-Brief afterwards), and 1,739,329 variants remained for imputation on the server. We used Eagle v2.4 for phasing, and minimac v4 v1.0.2 for imputation. We kept variants with imputation quality score r2 > 0.4 and MAF > 1% for analysis. A total of 8,950,360 variants remained for association analysis. We included for analysis 381 individuals who passed phenotype QC with complete BIS-Brief rating. From these, four failed genoty** QC, and one individual was removed due to cryptic relatedness (n = 376). The mega-GWAS analysis consisted of a total of 372 unrelated individuals adjusted for sex, genoty** batch, and population stratification (Supplementary Fig. 1). The mega-GWAS was used for colocalization analysis of the genome-wide association peak on chromosome 8. We identified 329 patients as European ancestry (defined as within 6 standard deviations from the 1000 Genomes60 European cluster in a principal component analysis). Among these, five patients had missing information on seizure frequency, so we used 324 individuals for the genome-wide association analysis. The current sample size is sufficient to detect genetic variants that explain 12% of the variance in the BIS-Brief score with 80% power after adjusting for multiple hypothesis testing at the genome-wide significance level. We adjusted for sex, genoty** batch, age at consent, population stratification, and the frequency of myoclonus or absence seizures. The relationship of the frequency of myoclonus or absence seizures, and its relationship with ASM and sex with trait impulsivity in JME, has been described previously and was thus adjusted for in current regression analyses6,25. All analyses were conducted in the European subset unless noted otherwise. Chromosome X (non-pseudoautosomal region) was analysed with males coded as zero for the reference allele and two for the alternate allele, under the assumption of X-inactivation61. Genome-wide significant loci were further investigated for replication of association with risk-taking phenotypes in the general population using publicly available summary statistics31,32. Variants with P ≤ 5 × 10−4 were annotated to the gene with the nearest transcription start site using the Ensembl Variant Effect Predictor (v94)62. This gene set was used as input in a GO enrichment analysis63,64, to test for enrichment in annotated pathways. One-sided hypergeometric tests were completed to identify over-representation of pathways42. To reduce the risk of false positive results, a permutation procedure65 was employed by randomly shuffling GWAS p values 2000 times, each time re-applying the P ≤ 5 × 10−4 threshold and calculating the hypergeometric test statistics. For one pathway, the final permutation-based p value was calculated as the percentage of the 2000 permutations that produced a p value less than or equal to the p value calculated from the non-permuted data. A pseudo count was added during this calculation to prevent calculating p values equal to 0. We queried the top associated genome-wide variant and the top associated variant for each of the nine presynaptic assembly enriched genes across PheWAS databases: GWAS Atlas (https://atlas.ctglab.nl/), Global Biobank Engine66, PheWeb67, and Gene Atlas68. We used PheWeb portals: UK Biobank: https://pheweb.org/MGI-freeze2/ Oxford Brain Imaging Genetics (BIG) Project: http://big.stats.ox.ac.uk/ fastGWA: https://yanglab.westlake.edu.cn/resources/ukb_fastgwa/imp/ Clum** and thresholding were used to calculate ADHD, risk taking, bipolar disorder, generalised epilepsy, and focal epilepsy PRS in individuals of European ancestry using PLINK v1.953. Five PRS were calculated. A Bonferroni-corrected critical value for significance would therefore be p < 0.05/5 = 0.01. The source of summary statistics used, variant filtering, clum** and thresholding details are summarised in Supplementary Table 1. PRS values were generated by weighting selected SNPs after clum** and thresholding by the additive scale effect (log10(OR)/Beta), and then summing over the variants. The PRS values were then centred to the mean. Association of PRSs with BIS-Brief was tested using linear regression with age, sex, and frequency of absence/myoclonic seizure as covariates in the model. We used the Simple Sum 236 and COLOC269 colocalization methods as implemented in LocusFocus70 (v1.4.9) to test for colocalization of the genome-wide peaks with eQTL analyses in brain tissues in GTEx v812, PsychENCODE34, and fetal brain35. For the genome-wide associated locus on chromosome 8, we performed colocalization analysis using both the mega-GWAS and Europeans-only GWAS. The required significance threshold, after multiple testing of all colocalization datasets analysed was 0.01. A BLAST search against the entire Protein Data Base (PDB) identified only one hit with a convincingly high E-value (1e-55) that pointed to the Chain L of the Kazal-like domain containing mice protein (7EEB). The search had a 26% identity and a coverage of 74%. After this hit, the other four identified sequences had E values > 0.002, clearly distinguishing between significant and non-significant hits. 7EEB is a large complex containing several subunits, among which is SLCO6C1, which is the region scoring for SLCO5A1. To assess the PVE by a SNP or a group of SNPs, we calculated the partial r2 as the proportion of the residual sum of squares (RSS) reduced when adding the SNP (or group of SNPs) to the base regression model with all covariates. Flies were maintained and crossed at 18 °C. All ageing was done in a controlled environment of 29 °C and 60% humidity. ubiGal80ts // UAS-Oatp30BIR (GD12775) obtained from the VDRC // w1118, nSyb-Gal4, TubGal4 and UAS-GFPIR obtained from the BDSC. Lifespan analysis was performed as previously reported41. All crosses were maintained at 18 °C during the developmental stages of the progeny. Newly eclosed adult flies were collected within 5 days at 18 °C. Females and males were pooled together and equally distributed within vials. Single-fly tracking was carried out as previously described41. In each of three experiments, up to 12 flies per genotype, aged 15 days (adult stage) at 29 °C to allow RNAi expression and knockdown, were placed into individual round six-wells arenas. The protocol used consisted of 6 stimuli events equally split during a period of 2 h and 15 min, the first one starting after 30 min of recording, and the last one 30 min before the end of the protocol. Each stimuli event was composed of five vibrations of 200 ms spaced by 500 ms. The x/y position of each single fly was tracked and analysed using the DART software in order to evaluate the relative speed and activity before, during and after the stimuli event. The speed analysis was used for the “Stimuli Response Trace” and the general activity used to deduce “Active Speed”, “Mean Bout Length” and “Inter-Bout Interval”, using a custom-made modification of the DART software40. Flies aged 15 days at 29 °C to allow RNAi expression and knockdown were isolated into new plastic vials without food for 10–20 min before immersion in a 42 °C water bath for 120 seconds. Each tube was video recorded during and post immersion and seizures were defined as a period of brief leg twitches, convulsions, and failure to maintain standing posture. Flies were, thereafter, allowed to recover at room temperature and the time to recover from seizure was calculated only for flies that had undergone seizures. All experiments were randomised and double-blinded. RNA was extracted as previously reported71 from 15 adult flies of both sexes, aged 15 days at 29 °C to allow RNAi expression and knockdown, using TriZol (Thermo-Fischer). cDNA was generated using SuperScript III Reverse Transcriptase (Thermo-Fischer). Quantitative PCR was performed in combination with qPCRBIO SyGreen Blue mix (PCR Biosystems) on Quantstudio 7 from real-time PCR system (Thermo-Fischer). eIF4a was used as housekee** control. The following oligos were used: Oatp30B Fw (GAATCCGACCAACCGCCTGA), Oatp30B Rv (ATGGATTCCTGCCGCCTGTG), eIF4a Fw (CGTGAAGCAGGAGAACTGG), eIF4a Rv (CATCTCCTGGGTCAGTTG). Further information on research design is available in the Nature Research Reporting Summary linked to this article.Genoty** quality control
Genotype imputation
Genome-wide association analysis
Gene enrichment analysis
Phenome-wide association study (PheWAS) analysis
PRS analysis
Colocalization analysis
Domain architecture of SLCO5A1
Phenotypic variance explained
siRNA probe design and knockdown of Oatp30B in Drosophila melanogaster
Drosophila
Stocks
Lifespan
Motor behaviour assay
Heat-induced seizure assay
RNA extraction and qPCR
Reporting summary
Data availability
eQTL data are available for download from GTEx (https://gtexportal.org/home), PsychENCODE (http://resource.psychencode.org/), and fetal brains (https://doi.org/10.6084/m9.figshare.6881825). GWAS summary statistics for this study are available for download from our website (https://lab.research.sickkids.ca/strug/softwareandresources/).
References
Daruna, J. H. & Barnes, P. A. In: The impulsive client: theory, research and treatment (eds W. G. McCown, J. L. Johnson, & M. B. Shure) 23–37 (American Psychological Association, 1993).
Niv, S., Tuvblad, C., Raine, A., Wang, P. & Baker, L. A. Heritability and longitudinal stability of impulsivity in adolescence. Behav. Genet. 42, 378–392 (2012).
Dalley, J. W. & Robbins, T. W. Fractionating impulsivity: neuropsychiatric implications. Nat. Rev. Neurosci. 18, 158–171 (2017).
Ramirez-Martin, A., Ramos-Martin, J., Mayoral-Cleries, F., Moreno-Kustner, B. & Guzman-Parra, J. Impulsivity, decision-making and risk-taking behaviour in bipolar disorder: a systematic review and meta-analysis. Psychol. Med. 50, 2141–2153 (2020).
Smith, A., Syvertsen, M. & Pal, D. K. Meta-analysis of response inhibition in juvenile myoclonic epilepsy. Epilepsy Behav. 106, 107038 (2020).
Shakeshaft, A. et al. Trait impulsivity in juvenile myoclonic epilepsy. Ann Clin Transl Neurol, https://doi.org/10.1002/acn3.51255 (2020).
Wandschneider, B. et al. Risk-taking behavior in juvenile myoclonic epilepsy. Epilepsia 54, 2158–2165 (2013).
Malloy-Diniz, L., Fuentes, D., Leite, W. B., Correa, H. & Bechara, A. Impulsive behavior in adults with attention deficit/ hyperactivity disorder: characterization of attentional, motor and cognitive impulsiveness. J. Int. Neuropsychol. Soc. 13, 693–698 (2007).
Sanchez-Roige, S. et al. Genome-wide association studies of impulsive personality traits (BIS-11 and UPPS-P) and drug experimentation in up to 22,861 adult research participants identify loci in the CACNA1I and CADM2 genes. J. Neurosci. 39, 2562–2572 (2019).
Barbeira, A. N. et al. Exploring the phenotypic consequences of tissue specific gene expression variation inferred from GWAS summary statistics. Nat. Commun. 9, 1825 (2018).
Schizophrenia Working Group of the Psychiatric Genomics, C. Biological insights from 108 schizophrenia-associated genetic loci. Nature 511, 421–427 (2014).
GTEx Consortium. The genotype-tissue expression (GTEx) project. Nat. Genet. 45, 580–585 (2013).
O’Muircheartaigh, J. et al. Focal structural changes and cognitive dysfunction in juvenile myoclonic epilepsy. Neurology 76, 34–40 (2011).
Keller, S. S. et al. Microstructural and volumetric abnormalities of the putamen in juvenile myoclonic epilepsy. Epilepsia 52, 1715–1724 (2011).
Landvogt, C., Buchholz, H.-G., Bernedo, V., Schreckenberger, M. & Werhahn, K. J. Alteration of dopamine D2/D3 receptor binding in patients with juvenile myoclonic epilepsy: alteration of dopamine D2/D3 receptor binding in JME. Epilepsia 51, 1699–1706 (2010).
Ciumas, C. et al. Reduced dopamine transporter binding in patients with juvenile myoclonic epilepsy. Neurology 71, 788–794 (2008).
Dalley, J. W., Everitt, B. J. & Robbins, T. W. Impulsivity, compulsivity, and top-down cognitive control. Neuron 69, 680–694 (2011).
Dalley, J. W. & Roiser, J. P. Dopamine, serotonin and impulsivity. Neuroscience 215, 42–58 (2012).
Deransart, C., Vercueil, L., Marescaux, C. & Depaulis, A. The role of basal ganglia in the control of generalized absence seizures. Epilepsy Res. 32, 213–223 (1998).
Cho, S. S. et al. Morphometric correlation of impulsivity in medial prefrontal cortex. Brain Topogr. 26, 479–487 (2013).
Santos, B. P. D. et al. Genetic susceptibility in juvenile myoclonic epilepsy: systematic review of genetic association studies. PLoS One 12, e0179629 (2017).
International League Against Epilepsy Consortium on Complex Epilepsies. Genome-wide mega-analysis identifies 16 loci and highlights diverse biological mechanisms in the common epilepsies. Nat. Commun. 9, 5269 (2018).
Bai, D. et al. DNA variants in coding region of EFHC1: SNPs do not associate with juvenile myoclonic epilepsy. Epilepsia 50, 1184–1190 (2008).
Bailey, J. N. et al. Variant intestinal-cell kinase in juvenile myoclonic epilepsy. N. Engl. J. Med. 378, 1018–1028 (2018).
Shakeshaft, A. et al. Sex-specific disease modifiers in juvenile myoclonic epilepsy. Sci. Rep. 12, 2785 (2022).
Li, M. et al. Antisense oligonucleotide therapy reduces seizures and extends life span in an SCN2A gain-of-function epilepsy model. J. Clin. Invest. 131, e152079 (2021).
Karalis, V. & Bateup, H. S. Current approaches and future directions for the treatment of mTORopathies. Dev. Neurosci. 43, 143–158 (2021).
Hall, M.-H. & Smoller, J. W. A new role for endophenotypes in the GWAS era: functional characterization of risk variants. Harv. Rev. Psychiatry. 18, 67–74 (2010).
Manchia, M. et al. The impact of phenotypic and genetic heterogeneity on results of genome wide association studies of complex diseases. PLoS One 8, e76295 (2013).
Steinberg, L., Sharp, C., Stanford, M. S. & Tharp, A. T. New tricks for an old measure: the development of the Barratt Impulsiveness Scale-Brief (BIS-Brief). Psychol. Assess. 25, 216–226 (2013).
Watanabe, K. et al. A global overview of pleiotropy and genetic architecture in complex traits. Nat. Genet. 51, 1339–1348 (2019).
Neale’s Lab UK Biobank GWAS Results Round 2 (Imputed v3 - File Manifest Release 20180731), http://www.nealelab.is/uk-biobank.
Kinirons, P. et al. A novel locus for idiopathic generalized epilepsy in French-Canadian families maps to 10p11. Am. J. Med. Genet. A 146A, 578–584 (2008).
Wang, D. et al. Comprehensive functional genomic resource and integrative model for the human brain. Science 362, https://doi.org/10.1126/science.aat8464 (2018).
O’Brien, H. E. et al. Expression quantitative trait loci in the develo** human brain and their enrichment in neuropsychiatric disorders. Genome Biol. 19, 194 (2018).
Wang, F., Panjwani, N., Wang, C., Sun, L. & Strug, L. J. A flexible summary statistics-based colocalization method with application to the mucin cystic fibrosis lung disease modifier locus. Am. J. Hum. Genet. 109, 253–269 (2022).
BrainSpan Atlas of the Develo** Human Brain [Internet], http://brainspan.org.
Sunkin, S. M. et al. Allen Brain Atlas: an integrated spatio-temporal portal for exploring the central nervous system. Nucleic Acids Res. 41, D996–D1008 (2013).
Sebastian, K. et al. Characterization of SLCO5A1/OATP5A1, a solute carrier transport protein with non-classical function. PLoS One 8, e83257 (2013).
Faville, R., Kottler, B., Goodhill, G. J., Shaw, P. J. & van Swinderen, B. How deeply does your mutant sleep? Probing arousal to better understand sleep defects in Drosophila. Sci. Rep. 5, 8454 (2015).
Mazaud, D. et al. Transcriptional regulation of the glutamate/GABA/glutamine cycle in adult glia controls motor activity and seizures in drosophila. J. Neurosci. 39, 5269–5283 (2019).
Falcon, S. & Gentleman, R. Using GOstats to test gene lists for GO term association. Bioinformatics 23, 257–258 (2007).
Liberzon, A. et al. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 1, 417–425 (2015).
Meissner, A. et al. Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature 454, 766–770 (2008).
Mikkelsen, T. S. et al. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448, 553–560 (2007).
Demontis, D. et al. Discovery of the first genome-wide significant risk loci for attention deficit/hyperactivity disorder. Nat. Genet. 51, 63–75 (2019).
Lawlor, D. A., Tilling, K. & Davey Smith, G. Triangulation in aetiological epidemiology. Int. J. Epidemiol. 45, 1866–1886 (2016).
Parker, L., Howlett, I. C., Rusan, Z. M. & Tanouye, M. A. Seizure and epilepsy: studies of seizure disorders in Drosophila. Int. Rev. Neurobiol. 99, 1–21 (2011).
Uhl, G. R. & Martinez, M. J. PTPRD: neurobiology, genetics, and initial pharmacology of a pleiotropic contributor to brain phenotypes. Ann. N Y Acad. Sci. 1451, 112–129 (2019).
Hu, Z., **ao, X., Zhang, Z. & Li, M. Genetic insights and neurobiological implications from NRXN1 in neuropsychiatric disorders. Mol. Psychiatry 24, 1400–1414 (2019).
Sanes, J. R. & Zipursky, S. L. Synaptic specificity, recognition molecules, and assembly of neural circuits. Cell 181, 536–556 (2020).
Miyamoto, H. et al. Impaired cortico-striatal excitatory transmission triggers epilepsy. Nat. Commun. 10, 1917 (2019).
Purcell, S. et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559–575 (2007).
Manichaikul, A. et al. Robust relationship inference in genome-wide association studies. Bioinformatics 26, 2867–2873 (2010).
Wigginton, J. E. & Abecasis, G. R. PEDSTATS: descriptive statistics, graphics and quality assessment for gene map** data. Bioinformatics 21, 3445–3447 (2005).
Conomos, M. P., Miller, M. B. & Thornton, T. A. Robust inference of population structure for ancestry prediction and correction of stratification in the presence of relatedness. Genet. Epidemiol. 39, 276–293 (2015).
Das, S. et al. Next-generation genotype imputation service and methods. Nat. Genet. 48, 1284–1287 (2016).
Fuchsberger, C., Abecasis, G. R. & Hinds, D. A. minimac2: faster genotype imputation. Bioinformatics 31, 782–784 (2015).
Taliun, D. et al. Sequencing of 53,831 diverse genomes from the NHLBI TOPMed Program. Nature 590, 290–299 (2021).
Genomes Project Consortium et al. A global reference for human genetic variation. Nature 526, 68–74 (2015).
Chen, B., Craiu, R. V., Strug, L. J. & Sun, L. The X factor: a robust and powerful approach to X-chromosome-inclusive whole-genome association studies. Genet. Epidemiol. 45, 694–709 (2021).
McLaren, W. et al. The ensembl variant effect predictor. Genome Biol. 17, 122 (2016).
Ashburner, M. et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 25, 25–29 (2000).
Gene Ontology, C. The Gene Ontology resource: enriching a GOld mine. Nucleic Acids Res. 49, D325–D334 (2021).
Backes, C. et al. Systematic permutation testing in GWAS pathway analyses: identification of genetic networks in dilated cardiomyopathy and ulcerative colitis. BMC Genomics 15, 622 (2014).
McInnes, G. et al. Global Biobank Engine: enabling genotype-phenotype browsing for biobank summary statistics. Bioinformatics 35, 2495–2497 (2019).
Gagliano Taliun, S. A. et al. Exploring and visualizing large-scale genetic associations by using PheWeb. Nat. Genet. 52, 550–552 (2020).
Canela-Xandri, O., Rawlik, K. & Tenesa, A. An atlas of genetic associations in UK Biobank. Nat. Genet. 50, 1593–1599 (2018).
Dobbyn, A. et al. Landscape of conditional eQTL in dorsolateral prefrontal cortex and co-localization with schizophrenia GWAS. Am. J. Hum. Genet. 102, 1169–1184 (2018).
Panjwani, N. et al. LocusFocus: web-based colocalization for the annotation and functional follow-up of GWAS. PLoS Comput. Biol. 16, e1008336 (2020).
Napoletano, F. et al. Polyglutamine Atrophin provokes neurodegeneration in Drosophila by repressing fat. EMBO J. 30, 945–958 (2011).
Pao, S. S., Paulsen, I. T. & Saier, M. H. Jr Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 62, 1–34 (1998).
Walmsley, A. R., Barrett, M. P., Bringaud, F. & Gould, G. W. Sugar transporters from bacteria, parasites and mammals: structure-activity relationships. Trends Biochem. Sci. 23, 476–481 (1998).
Madej, M. G., Dang, S., Yan, N. & Kaback, H. R. Evolutionary mix-and-match with MFS transporters. Proc. Natl Acad. Sci. USA 110, 5870–5874 (2013).
Acknowledgements
This work was supported by the Canadian Institutes of Health Research (CIHR) Operating Grant, FRN: 142405 (D.K.P., L.J.S.) and CIHR Foundation Grant, FRN: 167282 (L.J.S.); UK Medical Research Council, Centre for Neurodevelopmental Disorders MR/N026063/1 (D.K.P., M.P.R.); UK Medical Research Council, Programme Grant MR/K013998/1, (M.P.R.); PhD stipend from UK Medical Research Council and the Sackler Institute for Translational Neurodevelopment (A.S.); NIHR Specialist Biomedical Research Centre for Mental Health of South London and Maudsley National Health Service Foundation Trust (D.K.P., M.P.R.); UK Engineering and Physical Sciences Research Council, Centre for Predictive Modelling in Healthcare (EP/N014391/1 (M.P.R.)); DINOGMI Department of Excellence of MIUR 2018–2022 (legge 232 del 2016 (P.S.)); Wales BRAIN Unit and Research Delivery Staff funded by Welsh Government through Health and Care Research Wales (K.H.); Biomarin srl, ENECTA srl, GW Pharmaceuticals, Kolfarma srl. and Eisai (P.S.); South-Eastern Regional Health Authority, Norway (Project Number 2016129 (K.K.S.)); The Research Council of Norway (Project Number 299266 (M.S.)); Epilepsy Research UK (RHT, M.P.R.); Health & Care Research Wales (M.P.R.), Wales Gene Park (M.P.R.), Abertawe Bro Morgannwg University NHS R&D (M.P.R.); UCB (G.R.); Nationwide Children’s Hospital (D.A.G.); Odense University Hospital (J.G.); University of Southern Denmark (17/18517 (C.P.B.)); Grants NC/V001051/1 from the NC3Rs (M.F.), European Union’s Horizon 2020 Research and Innovation Programme (765912 - DRIVE - H2020-MSCA-ITN-2017 (H.J.)) and Action Medical Research (GN2446 (H.J., M.F.)). L.J.S. is a Canada Research Chair and this research was undertaken, in part, thanks to funding from the Canada Research Chairs Programme. Work supported by #NEXTGENERATIONEU (NGEU) and funded by the Ministry of University and Research (MUR), National Recovery and Resilience Plan (NRRP), project MNESYS (PE0000006)–A Multiscale integrated approach to the study of the nervous system in health and disease (DN. 1553 11.10.2022)- IRCCS ‘G. Gaslini’ is a meber of ERN-Epicare.
Author information
Authors and Affiliations
Consortia
Contributions
L.J.S. and D.K.P. contributed to the conception and study design. D.R., N.P., A.S., A.C., F.L., A.H., K.K., D.K.P. and L.J.S. contributed to data management and project administration. D.M.A., C.P.B., C.Y.F., E.G., J.G., D.A.G., C.D., F.M., K.H., K.S.L., R.S.M., C.C.N., A.O., K.K.S., G.R., P.S., M.S., I.T., R.H.T., J.Z., M.P.R., D.K.P. and L.J.S. contributed to acquisition of study data. D.R., E.J.S., N.P., A.S., C.D., F.M., S.T., H.J., M.P.R., A.P., M.F., D.K.P. and L.J.S. contributed to analysis of data. D.R., E.J.S., N.P., A.S., M.F., L.J.S., and D.K.P. contributed to drafting the manuscript. Members of the BIOJUME consortium are listed in the appendix.
Corresponding authors
Ethics declarations
Competing interests
D.A., K.K.S., R.H.T. and J.Z. report honoraria from UCB Pharma (manufacturer of levetiracetam) and R.H.T. reports honoraria from Sanofi (manufacturer of sodium valproate). K.H. reports honoraria from UCB Pharma, Eisai and GW Pharma. M.S. reports honoraria from UCB Pharma and Eisai. G.R. reports honoraria from UCB Pharma (manufacturer of levetiracetam), from EISAI (manufacturer of perampanel), from Angelini Pharma (manufacturer of cenobamate). R.H.T. reports honorarium from Arvelle/Angelini, Bial, Eisai, GW Pharma/Jazz, Zogenix. All other authors report no competing interests.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Roshandel, D., Sanders, E.J., Shakeshaft, A. et al. SLCO5A1 and synaptic assembly genes contribute to impulsivity in juvenile myoclonic epilepsy. npj Genom. Med. 8, 28 (2023). https://doi.org/10.1038/s41525-023-00370-z
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41525-023-00370-z
- Springer Nature Limited