Epidermal-specific deletion of TC-PTP promotes UVB-induced epidermal cell survival through the regulation of Flk-1/JNK signaling

Baek, Minwoo; Kim, Mihwa; Lim, Jae Sung; Morales, Liza D.; Hernandez, Joselin; Mummidi, Srinivas; Williams-Blangero, Sarah; Jang, Ik-Soon; Tsin, Andrew T.; Kim, Dae Joon

doi:10.1038/s41419-018-0781-9

Epidermal-specific deletion of TC-PTP promotes UVB-induced epidermal cell survival through the regulation of Flk-1/JNK signaling

Article
Open access
Published: 28 June 2018

Volume 9, article number 730, (2018)
Cite this article

Download PDF

You have full access to this open access article

Cell Death & Disease

Epidermal-specific deletion of TC-PTP promotes UVB-induced epidermal cell survival through the regulation of Flk-1/JNK signaling

Download PDF

Minwoo Baek¹^na1^nAff5,
Mihwa Kim¹^na1,
Jae Sung Lim¹^na1,
Liza D. Morales^2,3,
Joselin Hernandez^2,3,
Srinivas Mummidi^2,3,
Sarah Williams-Blangero^2,3,
Ik-Soon Jang ORCID: orcid.org/0000-0003-2092-6372⁴,
Andrew T. Tsin¹ &
…
Dae Joon Kim ORCID: orcid.org/0000-0002-7977-9955^1,2

1366 Accesses
11 Citations
Explore all metrics

Abstract

UVB exposure can contribute to the development of skin cancer by modulating protein tyrosine kinase (PTK) signaling. It has been suggested that UVB radiation increases the ligand-dependent activation of PTKs and induces PTP inactivation. Our recent studies have shown that T-cell protein tyrosine phosphatase (TC-PTP) attenuates skin carcinogenesis induced by chemical regimens, which indicates its critical role in the prevention of skin cancer. In the current work, we report that TC-PTP increases keratinocyte susceptibility to UVB-induced apoptosis via the downregulation of Flk-1/JNK signaling. We showed that loss of TC-PTP led to resistance to UVB-induced apoptosis in vivo epidermis. We established immortalized primary keratinocytes (IPKs) from epidermal-specific TC-PTP-deficient (K14Cre.Ptpn2^fl/fl) mice. Immortalized TC-PTP-deficient keratinocytes (TC-PTP/KO IPKs) showed increased cell survival against UVB-induced apoptosis which was concomitant with a UVB-mediated increase in Flk-1 phosphorylation, especially on tyrosine residue 1173. Inhibition of Flk-1 by either its specific inhibitors or siRNA in TC-PTP/KO IPKs reversed this effect and significantly increased cell death after UVB irradiation in comparison with untreated TC-PTP/KO IPKs. Immunoprecipitation analysis using the TC-PTP substrate-trap** mutant TCPTP-D182A indicated that TC-PTP directly interacts with Flk-1 to dephosphorylate it and their interaction was stimulated by UVB. Following UVB-mediated Flk-1 activation, the level of JNK phosphorylation was also significantly increased in TC-PTP/KO IPKs compared to control IPKs. Similar to our results with Flk-1, treatment of TC-PTP/KO IPKs with the JNK inhibitor SP600125 significantly increased apoptosis after UVB irradiation, confirming that the effect of TC-PTP on UVB-mediated apoptosis is regulated by Flk-1/JNK signaling. Western blot analysis showed that both phosphorylated Flk-1 and phosphorylated JNK were significantly increased in the epidermis of TC-PTP-deficient mice compared to control mice following UVB. Our results suggest that TC-PTP plays a protective role against UVB-induced keratinocyte cell damage by promoting apoptosis via negative regulation of Flk-1/JNK survival signaling.

Overexpression of TC-PTP in murine epidermis attenuates skin tumor formation

Article 14 April 2020

Targeted disruption of TC-PTP in the proliferative compartment augments STAT3 and AKT signaling and skin tumor development

Article Open access 21 March 2017

Targeting PRPK and TOPK for skin cancer prevention and therapy

Article 14 June 2018

Introduction

Skin is the largest organ of the human body. Its function is to provide protection and receive stimuli from the environment; consequently, skin undergoes a great deal of environmental assault. Ultraviolet (UV) irradiation from sunlight is a principal environmental factor that can contribute to the development of all three major types of skin cancer: squamous cell carcinomas, basal cell carcinomas, and cutaneous melanomas. Of the three different ranges of UV, UVB (280–315 nm) radiation is the most significant in causing skin cancers^1,2,3. Exposure to UVB radiation damages DNA, giving rise to mutations in any number of genes, including oncogenes and tumor suppressor genes, which can modulate cellular signaling pathways involved in DNA damage repair, growth, apoptosis, and differentiation. Following UVB exposure, irreparable DNA-damaged keratinocytes undergo cell death, or apoptosis, through different pathways that involve the activation of the tumor suppressor gene p53 and cell death receptor signaling. However, aberrant keratinocytes that have managed to survive or bypass apoptosis can start to proliferate during continuous UVB radiation, resulting in the development of UVB-induced skin cancer^4,5,6.

T-cell protein tyrosine phosphatase (TC-PTP, encoded by PTPN2) is a tyrosine-specific intracellular non-receptor PTP. Members of the PTP family share a highly conserved motif that is required for dephosphorylation of their target substrate proteins, a reversible posttranslational modification that can active or deactivate proteins. PTPs have been implicated in the pathogenesis of a wide range of human diseases and have become attractive targets for clinical therapies⁷. TC-PTP is ubiquitously expressed in embryonic and adult tissues^8,9. Alternative splicing of PTPN2 generates two distinct forms of TC-PTP: a 45-kDa form known as TC45 (TC-PTPa) and a longer 48-kDa form known as TC48 (TC-PTPb). TC45 is targeted to the nucleus by a bipartite nuclear localization signal in its C terminus^10,11. However, our recent studies have shown that TC45 is localized in the cytoplasm of skin keratinocytes and it is translocated to the nucleus in response to UVB irradiation via an AKT/14-3-3σ-dependent mechanism, demonstrating that tissue type is a factor in TC45 subcellular localization¹². TC48 is a minor form of TC-PTP that is targeted to the endoplasmic reticulum by its hydrophobic C terminus^10,11. TC-PTP modulates various cellular functions, including cell cycle regulation, proliferation, and apoptosis. TC-PTP has been well-studied due to its critical role in the regulation of diabetes and obesity through its ability to modulate insulin and leptin signaling¹³. For example, neuronal cell-specific TC-PTP-deficient mice showed reduced high-fat-diet-induced weight gain and enhanced leptin sensitivity in the hypothalamus with increased STAT3 phosphorylation after leptin administration, indicating that TC-PTP is involved in the development of leptin resistance via STAT3¹⁴.

Our work has revealed that TC-PTP is also essential to the skin response to UVB radiation or a two-stage chemical regimen which consists of the carcinogens 7,12-dimethylbenz[a]anthracene (DMBA) and 12-O-tetradecanoylphorbol-13-acetate (TPA). Initial studies of PTPs in skin showed that PTP expression is induced during keratinocyte proliferation and maturation, but expression levels remain unchanged within epidermal tissue¹⁵. It has been demonstrated that exposure to acute UV irradiation or treatment with the tumor promoter TPA increases the activation of protein tyrosine kinases, including the epidermal growth factor receptor (EGFR) and the downstream STAT3 signaling pathway^{Full size image}

To confirm whether TC-PTP directly dephosphorylates Flk-1, the substrate-trap** mutant TC-PTP/D182A, which lacks phosphatase activity, was produced by substituting its essential catalytic residue aspartic acid (D) to alanine (A) and then, a TC-PTP/KO IPK cell line that overexpresses TC-PTP/D182A with a FLAG epitope tag was generated by lentiviral transduction. The mutant TC-PTP/D182A was immunoprecipitated with an anti-FLAG antibody from TC-PTP/D182A-overexpressing TC-PTP/KO IPKs and probed with an anti-Flk-1 antibody. As shown in Fig. 5e, interaction of TC-PTP with Flk-1 was increased following UVB irradiation. Pretreatment with Na₃VO₄ before UVB exposure blocked their interaction. Immunoprecipitation of Flk-1 in the presence or absence of Na₃VO₄ confirmed its interaction with TC-PTP after UVB irradiation (Fig. 5f). Consistent with these results, the level of phosphorylated Flk-1 at Y1173 was significantly increased after UVB exposure in the presence of Na₃VO₄ (Fig. 5g). Together, these results indicate that TC-PTP promotes an apoptotic response in keratinocytes upon UVB irradiation by directly dephosphorylating Y1173 in Flk-1.

JNK is a downstream signal of Flk-1 that is responsible for UVB-induced keratinocyte survival

In keratinocytes, UVB irradiation can initially stimulate ERK and JNK activation to protect cells against UVB-induced apoptosis^41,42, which implies that ERK or JNK are potential downstream targets of TC-PTP/Flk-1. Therefore, we examined the levels of phosphorylated ERK and phosphorylated JNK in TC-PTP/WT and TC-PTP/KO IPKs in response to UVB irradiation. Both phosphorylated ERK and phosphorylated JNK expression levels were increased after UVB irradiation (Fig. 6a). While the level of phosphorylated ERK was similarly increased in both types of cells after UVB irradiation, the level of phosphorylated JNK was significantly increased in TC-PTP/KO IPKs compared to TC-PTP/WT IPKs following UVB irradiation (Fig. 6a). To examine whether JNK is involved in UVB-induced apoptosis, IPKs were treated with the JNK-specific inhibitor SP600125 before UVB irradiation. Pretreatment with SP600125 before UVB exposure effectively reduced the level of phosphorylated JNK in both genotypes of IPKs (Fig. 6b). Pretreatment of the JNK inhibitor before UVB exposure reduced cell viability in both TC-PTP/WT and TC-PTP/KO IPKs in comparison to untreated controls. However, the reduction in cell viability of TC-PTP/KO IPKs was higher compared to that in TC-PTP/WT IPKs (Fig. 6c). Consistent with this result, pretreatment of the JNK inhibitor before UVB exposure significantly increased TUNEL-positive apoptotic cells in TC-PTP/KO IPKs to a level comparable with that in TC-PTP/WT IPKs (Fig. 6d, e), which is similar to the results we obtained using Flk-1 inhibitors (Fig. 4g, h). Western blot analysis showed that the levels of both cleaved PARP and cleaved caspase-3 expression were increased in TC-PTP/KO IPKs with pretreatment of the JNK inhibitor, while their expression levels were not changed in TC-PTP/WT IPKs (Fig. 6f). In addition, inhibition of Flk-1 expression or phosphorylation by either siRNA or inhibitors, respectively, reduced the level of phosphorylated JNK in IPKs after UVB irradiation (Fig. 6g, h), demonstrating that JNK is a downstream signaling target of Flk-1.

**Fig. 6: JNK is a downstream signaling target of Flk-1 in the regulation of UVB-induced apoptosis.**

To examine TC-PTP-mediated regulation of Flk-1/JNK signaling during the response to UVB irradiation in vivo, both TC-PTP/WT and TC-PTP/KO mice were irradiated with UVB, and epidermal cell lysates were prepared for western blot analysis. As shown in Fig. 7a, the levels of phosphorylated Flk-1 and phosphorylated JNK in the epidermis of TC-PTP KO mice were significantly increased in comparison to control mice, especially 1 h after UVB exposure. Collectively, our findings indicate that TC-PTP negatively regulates Flk-1/JNK signaling via direct dephosphorylation of Flk-1 on its Y1173 residue, which contributes to increased epidermal apoptosis in response to UVB exposure (Fig. 7b).

**Fig. 7: Activation of Flk-1/JNK signaling axis in the epidermis of TC-PTP- deficient mice following UVB exposure.**

Discussion

PTPs are involved in the regulation of various physiological processes, including growth, differentiation, metabolism, and motility, and their activation/inhibition have been implicated in various types of cancers including skin cancer^43,44. Our previous study suggested that three PTPs––TC-PTP, SHP1, and SHP2––play a role in UVB-induced epidermal apoptosis and proliferation through the dephosphorylation of STAT3, a major oncogenic transcription factor in skin¹². Further study demonstrated that TC-PTP is a more significant negative regulator of STAT3 in keratinocytes²¹. TC-PTP is mainly localized to the cytoplasm and then is translocated to the nucleus following UVB exposure, which leads to the dephosphorylation of STAT3 in the nucleus and the promotion of apoptosis⁴⁵. In the current study, we describe an additional novel mechanism for TC-PTP-mediated regulation of UVB-induced epidermal apoptosis. UVB irradiation initially induces Flk-1 phosphorylation, particularly at Y1173 (Y1175 in human), but then TC-PTP directly dephosphorylates Flk-1, which leads to the inhibition of JNK activation and results in the promotion of UVB-induced apoptosis. Inhibition of either Flk-1 or JNK activation recovered the UVB-mediated apoptotic response that was reduced by loss of TC-PTP in TC-PTP/KO IPKs (Fig. 7b). Studies showed that Flk-1 can induce STAT3 phosphorylation in a ligand-independent manner in brain tumors⁴⁶. This finding implies that Flk-1 may also contribute to enhanced keratinocyte survival following UVB exposure by triggering the activation of STAT3 survival signaling. Our work suggests that TC-PTP is a major regulator of UVB-induced epidermal apoptosis through its ability to dephosphorylate both Flk-1 in the cytoplasm and STAT3 in the nucleus.

Flk-1/VEGFR2 is a well-known, major VEGF signaling receptor that plays important roles in endothelial cell proliferation, migration, survival, and angiogenesis³⁹. Studies showed that it is expressed in keratinocytes²⁴. Flk-1 is overexpressed in psoriatic epidermal keratinocytes and its expression is regulated by calcium, independent of VEGF⁴⁷. In particular, studies showed that Flk-1 expression and phosphorylation on Y1173, which is independent of VEGF, was increased by UVB irradiation in human keratinocytes. Inhibition of Flk-1 expression promoted UVB-induced cell apoptosis²⁶. Furthermore, Mattila et al. showed that TC-PTP can attenuate endothelial cell proliferation, migration, and sprouting angiogenesis by directly dephosphorylating Flk-1³⁸. Consistent with these studies, tyrosine phosphorylation of Flk-1 on Y1173 was increased in mouse keratinocytes after UVB irradiation, and TC-PTP deficiency further increased the level of phosphorylated Flk-1 (Fig. 4a, b). Additionally, we demonstrated that UVB-induced activation of Flk-1 is negatively regulated by TC-PTP through direct dephosphorylation (Fig. 5e), resulting in enhanced apoptosis (Figs. 4h and 5d). Use of a TC-PTP substrate-trap** mutant for immunoprecipitation analysis showed that TC-PTP dephosphorylates four different tyrosine residues of Flk-1––Y1052, Y1057, Y1212, and Y994––in human umbilical vein endothelial cells; however, it did not dephosphorylate the Y1173 residue of Flk-1³⁸. Our results also showed that TC-PTP dephosphorylates Flk-1 in a phosphorylation site-specific manner in keratinocytes following UVB exposure. However, in contrast to endothelial cells, TC-PTP dephosphorylates only one residue, Y1173, out of seven major putative tyrosine phosphorylation sites in Flk-1 (Fig. 4b).

It is known that JNK activation is induced by extracellular stresses, such as TNFα and UV irradiation, to promote apoptosis^33,34. However, the exact role of JNK in apoptosis is still controversial. Recent studies showed that UVB-mediated JNK activation protects keratinocytes from apoptosis by stimulating autophagy⁴², indicating that further studies are needed to elucidate the exact function and mechanism of JNK activation in terms of apoptosis. Similar with recent studies, our results showed an antiapoptotic function of JNK activation in response to UVB exposure. In the absence of TC-PTP, Flk-1-mediated activation of JNK significantly reduced UVB-mediated apoptosis. The inhibition of its activation in TC-PTP/KO cells by specific inhibitor SP600125 recovered the extent of apoptosis after UVB, which is comparable with that observed in TC-PTP/WT cells (Fig. 6d, e). Inhibition or inactivation of Flk-1 suppressed UVB-mediated JNK activation (Fig. 6g, h). UVB irradiation activates not only JNK, but also ERK in keratinocytes^41,42. Similarly, we found that UVB irradiation induced ERK phosphorylation, but its activation was not affected by TC-PTP or TC-PTP-mediated activation of Flk-1 (Fig. 6a).

In conclusion, use of our epidermal-specific TC-PTP knockout mouse model and the generation of immortalized keratinocyte cell lines from this model allowed us to uncover a novel mechanism by which TC-PTP promotes epidermal apoptosis in response to UVB exposure. TC-PTP dephosphorylates activated Flk-1 at Y1173 after UVB irradiation, which is followed by the suppression of JNK phosphorylation. TC-PTP-mediated downregulation of Flk-1/JNK signaling leads to enhanced apoptosis in UVB-irradiated keratinocytes. Our findings indicate that TC-PTP contributes to the removal of UVB-damaged keratinocytes by promoting apoptosis via the negative regulation of Flk-1/JNK signaling, and modulation of TC-PTP regulatory signaling and/or use of TC-PTP activators is a potential therapeutic strategy for the prevention of skin carcinogenesis.

Materials and methods

TC-PTP knockout (K14Cre.Ptpn2 ^fl/fl) mice and UVB irradiation

Development of epidermal-specific TC-PTP knockout (K14Cre.Ptpn2^fl/fl) mice has been described previously²². Female transgenic and non-transgenic littermates at 7~8 weeks of age were used for the described experiments. The dorsal skin of each mouse was shaved 48 h before UVB irradiation; only those mice in the resting phase of the hair cycle were used. For UVB irradiation, Westinghouse FS20 sun lamp bulbs with a peak emission at 313 nm were used. The fluence rate was measured with an IL1400A Radiometer/Photometer coupled to a SEL240/UVB-1/TD detector (International Light, Inc., Newburyport, MA, USA). Each mouse was held in individual compartments of a plastic cage on a rotating base to prevent any influence of the differences across the UVB-light bulbs. A UVB-transparent lid covering the radiation chamber was used to filter out the small amount of UVC radiation emitted from these lamps. All experiments with mice were carried out with strict adherence to both institutional and National Institutes of Health (NIH) guidelines for minimizing distress in experimental animals, and all experiments including mice were approved by the University of Texas Rio Grande valley Institutional Animal Care and Use Committee (IACUC).

Establishment of immortalized primary keratinocyte cell lines

Primary keratinocytes obtained from 2-day-old K14Cre.Ptpn2^w/w (TC-PTP/WT) or K14Cre.Ptpn2^fl/fl (TC-PTP/KO) neonates were cultured in keratinocyte growth medium (PromoCell, #C-20211, C-39011) containing 1% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37 °C and 5% CO₂ according to the previously described method⁴⁸. Mouse immortalized keratinocyte cell lines were established by using pLenti CMV/TO SV40 small + large T (Addgene, #22298). Viral packaging using 293T cells and titration of viruses were performed by using ViraPower^TM Lentiviral Packaging Mix (Invitrogen, K497500). The packed virus was concentrated by Lenti-X^TM Concentrator (Clontech, 631231). For establishing stable immortalized keratinocyte cell lines, primary keratinocyte cells were infected with lentivirus containing the pLenti SV40 small + large T-antigen-expressing vector. After transduction, cells were cultured with keratinocyte growth medium for over ten passages to select for the clones capable of growing indefinitely.

Cell culture and UVB irradiation

Primary keratinocytes and immortalized primary keratinocytes (IPKs) obtained from 2-day-old K14Cre.Ptpn2^fl/fl or K14Cre.Ptpn2^w/w neonates were cultured in keratinocyte growth medium containing 1% FBS and 1% penicillin/streptomycin at 37 °C and 5% CO₂ until 80–85% confluent, at which time cells were irradiated with UVB (5 or 10 mJ/cm²). Prior to UVB irradiation, keratinocytes were washed with DPBS. A small volume of DPBS was added to coat keratinocytes with a thin layer of DPBS, and then keratinocytes were irradiated with UVB. Immediately after irradiation, DPBS was removed, and prewarmed medium was added to cells for additional culture before harvest. Human A431 (ATCC^® CRL-1555™, epidermoid carcinoma) or human MG-63 (ATCC^® CRL-1427™, osteosarcoma) cells were cultured in DMEM containing 10% FBS.

Soft agar colony formation assay

Soft agar colony formation assay was performed in six-well plates to evaluate anchorage-independent proliferation potential of IPKs generated from K14Cre.Ptpn2^fl/fl or K14Cre.Ptpn2^w/w mice. The bottom layer of each well was prepared with 2 ml of keratinocyte growth medium containing 0.6% low-melting-point agarose (Lonza, #50080). After plating, the bottom layer was solidified at 4 °C. The top layer of each well was prepared with 1 ml of keratinocyte growth medium containing 0.6% low-melting-point agarose and 5 × 10⁴ IPKs and then plated on the top of the bottom layer. After solidification of the top layer at 4 °C, 1 ml of keratinocyte growth medium was added to the top layer. Cells were allowed to grow at 37 °C and 5% CO₂ for 14 days. Cells were fixed in 4% paraformaldehyde and stained with 0.005% crystal violet. The experiments were repeated in triplicate.

Small interfering RNAs and inhibitors

Keratinocytes were grown overnight to ~40–60% confluence and transfected with control siRNA (Santa Cruz Biotechnology, sc-45924) or Flk-1-specific siRNA (Santa Cruz Biotechnology, sc-35390). Transfection was performed with Lipofectamine^® RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

For inhibition of Flk-1 or JNK, IPK cells were preincubated with Flk-1 inhibitors (SU5416 or ZD6474) or the JNK inhibitor (SP600125) for 1 h. After UVB exposure (10 mJ/cm²), cells were incubated with an inhibitor again until they were collected. All three inhibitors were obtained from Selleck Chemical LLC.

Analysis of UVB-induced apoptosis in keratinocytes and epidermis

Terminal DNA transferase-mediated dUTP nick-end labeling (TUNEL) assay was performed to investigate UVB-induced apoptosis in keratinocytes. IPKs were cultured and irradiated with UVB. After UVB irradiation, apoptotic cells were detected using In Situ Cell Death Detection Kit, Fluorescein (Roche Applied Sciences) following the manufacturer’ instructions. Apoptotic cells were using Leica DM 6000 fluorescent microscope, and data were presented as the average percentage of apoptotic cells/frame/slide examined.

To analyze UVB-induced epidermal apoptosis, groups of K14Cre.Ptpn2^w/w and K14Cre.Ptpn2^fl/fl mice (n = 3/group) were irradiated with UVB (120 mJ/cm²) and sacrificed 24 h and 48 h after irradiation. Skin sections were stained with an antibody to the active form of caspase 3 (R&D Systems) and then treated with a biotinylated anti-rabbit IgG-conjugated ABD reagent (BD Biosciences). Apoptotic keratinocytes were counted manually under phase contrast from at least three random, non-overlap** fields of view of tissue sections from three individual mice.

Cell viability assay

Cell viability was assessed using a 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt (WST-1) (Do**do Laboratories, Japan) colorimetric assay. Briefly, IPKs were plated at a density of 2 × 10⁴ cells/well in a 48-well plate. Then, cells were irradiated with UVB as described above and reincubated for 24 h. Then, the formazan dye was added to each well and absorbance was measured at 450 nm.

Establishment of the substrate-trap** mutant TC-PTP/D182A overexpressing stable cell lines

Stable IPK cell lines overexpressing TC-PTP substrate-trap** mutant (referred to as TC-PTP/D182A) were derived using IPKs derived from K14Cre.Ptpn2^w/w mice, as described above and established by lentiviral transduction with a modified lentiviral system based on Gateway^® cloning technology (Invitrogen)⁴⁹. Wild-type mouse TC-PTP (45-kDa) cDNA from pEF-1α/pENTR B TC-PTP²¹ was amplified by PCR and cloned into the lentivirus entry vector pENTR4-FLAG (Addgene #17423). pENTR4-FLAG TC-PTP was then mutated by QuikChange^® site-directed mutagenesis kit (Stratagene) to generate TC-PTP/D182A using the corresponding site-specific mutant primers: TC-PTP_D182A_Fwd (TATACCACCTGGCCAGCTTTTGGGGTTCCAGAG) and TC-PTP_D182A_Rev (CTCTGGAACCCCAAAAGCTGGCCAGGTGGTATA). Gateway^® LR Clonase^® enzyme mix (Invitrogen) was used to catalyze an LR recombination reaction between the entry vectors expressing the TC-PTP/D182A mutant and the destination vector to generate the final lentiviral expression clones for the TC-PTP/D182A mutant. Then, TC-PTP/KO IPKs were infected with lentiviral particles from the lentiviral expression clones and selected with puromycin.

Immunoprecipitation

Total cell lysates were prepared with Nonidet P-40-containing immunoprecipitation buffer (40 mM Tris, pH 7.4, 120 mM NaCl, 10 mM EDTA, and 0.1% (v/v) Nonidet P-40) containing protease inhibitor mixture, and phosphatase inhibitor cocktail I and II. Prior to immunoprecipitation, antibodies are incubated with magnetic Dynabeads™ Protein G (Invitrogen), and 2 mg of protein lysates were added into anti-FLAG (anti-FLAG^® M2) or anti-Flk-1-attached magnetic beads and incubated overnight at 4 °C. After immunoprecipitation, the beads were washed three times with washing buffer, and then the immune complexes were eluted from the beads and subjected to SDS-PAGE and immunoblot analysis.

Preparation of protein lysates and western blot analysis

Total cell lysates from both keratinocytes and the epidermis were prepared with RIPA buffer (Thermo Fisher Scientific) containing 1% Triton X-100, protease inhibitor cocktail (Sigma-Aldrich), and phosphatase inhibitor cocktail I and II (Sigma-Aldrich). Equal amounts of total protein were resolved using SDS-PAGE and transferred to the PVDF membrane (GE Healthcare). The membrane was incubated overnight at 4 °C with a primary antibody, followed by incubation with a secondary antibody conjugated to horseradish peroxidase. Enhanced chemiluminescence detection reagents (Pierce) were used to detect immunoreactive protein. The following antibodies were used: anti-phospho-Flk-1 (Tyr949) (#2471); anti-phospho-Flk-1 (Tyr994) (#2474); anti-phospho-Flk-1 (Tyr1173) (#2478); anti-Flk-1 (# 9698); anti-phospho-STAT3 (#9145); anti-STAT3 (#9139); anti-phospho-ERK (#4370); anti-ERK (#4695); anti-phospho-JNK (#4668); anti-JNK (#9258); anti-Bcl-xL (#2762); anti-Bax (#2772); anti-TC-PTP (#58935); anti-cleaved caspase 3 (#9664); and anti-PARP (#9542) from Cell Signaling Technology; anti-phospho-Flk-1 (Tyr1052/1057) (#44-1047G); anti-phospho-Flk-1 (Tyr1212) (#44-1052) from Invitrogen; anti-phospho-Flk-1 (Tyr779) (#VP2921) from ECM Biosciences; anti-β-actin (sc-47778) from Santa Cruz Biotechnology; anti-FLAG^® M2 (#F3165) from Sigma-Aldrich; and anti-CD44 (#NBP1-47386) from Novus Biologicals.

References

Sarasin, A. The molecular pathways of ultraviolet-induced carcinogenesis. Mutat. Res. 428, 5–10 (1999).
Article PubMed CAS Google Scholar
Kraemer, K. H. Sunlight and skin cancer: another link revealed. Proc. Natl Acad. Sci. USA 94, 11–14 (1997).
Article PubMed PubMed Central CAS Google Scholar
Ichihashi, M. et al. UV-induced skin damage. Toxicology 189, 21–39 (2003).
Article PubMed CAS Google Scholar
Daya-Grosjean, L. & Sarasin, A. The role of UV induced lesions in skin carcinogenesis: an overview of oncogene and tumor suppressor gene modifications in xeroderma pigmentosum skin tumors. Mutat. Res. 571, 43–56 (2005).
Article PubMed CAS Google Scholar
de Gruijl, F. R., van Kranen, H. J. & Mullenders, L. H. UV-induced DNA damage, repair, mutations and oncogenic pathways in skin cancer. J. Photochem. Photobiol. B. 63, 19–27 (2001).
Article PubMed Google Scholar
Kulms, D. & Schwarz, T. Molecular mechanisms of UV-induced apoptosis. Photodermatol. Photoimmunol. Photomed. 16, 195–201 (2000).
Article PubMed CAS Google Scholar
Zhang, Z. Y. Protein tyrosine phosphatases: prospects for therapeutics. Curr. Opin. Chem. Biol. 5, 416–423 (2001).
Article PubMed CAS Google Scholar
Cool, D. E. et al. cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family. Proc. Natl Acad. Sci. USA 86, 5257–5261 (1989).
Article PubMed PubMed Central CAS Google Scholar
Mosinger, B. Jr, Tillmann, U., Westphal, H. & Tremblay, M. L. Cloning and characterization of a mouse cDNA encoding a cytoplasmic protein-tyrosine-phosphatase. Proc. Natl Acad. Sci. USA 89, 499–503 (1992).
Article PubMed PubMed Central CAS Google Scholar
Tillmann, U., Wagner, J., Boerboom, D., Westphal, H. & Tremblay, M. L. Nuclear localization and cell cycle regulation of a murine protein tyrosine phosphatase. Mol. Cell Biol. 14, 3030–3040 (1994).
Article PubMed PubMed Central CAS Google Scholar
Kamatkar, S., Radha, V., Nambirajan, S., Reddy, R. S. & Swarup, G. Two splice variants of a tyrosine phosphatase differ in substrate specificity, DNA binding, and subcellular location. J. Biol. Chem. 271, 26755–26761 (1996).
Article PubMed CAS Google Scholar
Kim, D. J., Tremblay, M. L. & Digiovanni, J. Protein tyrosine phosphatases, TC-PTP, SHP1, and SHP2, cooperate in rapid dephosphorylation of Stat3 in keratinocytes following UVB irradiation. PLoS One 5, e10290 (2010).
Article PubMed PubMed Central CAS Google Scholar
Zhang, Z. Y., Dodd, G. T. & Tiganis, T. Protein tyrosine phosphatases in hypothalamic insulin and leptin signaling. Trends Pharmacol. Sci. 36, 661–674 (2015).
Article PubMed CAS Google Scholar
Loh, K. et al. Elevated hypothalamic TCPTP in obesity contributes to cellular leptin resistance. Cell. Metab. 14, 684–699 (2011).
Article PubMed PubMed Central CAS Google Scholar
Hendriks, W. et al. Protein-tyrosine phosphatases expressed in mouse epidermal keratinocytes. J. Invest. Dermatol. 106, 972–976 (1996).
Article PubMed CAS Google Scholar
**an, W. et al. Activation of the epidermal growth factor receptor by skin tumor promoters and in skin tumors from SENCAR mice. Cell Growth Differ. 6, 1447–1455 (1995).
PubMed CAS Google Scholar
Rho, O., Beltran, L. M., Gimenez-Conti, I. B. & DiGiovanni, J. Altered expression of the epidermal growth factor receptor and transforming growth factor-alpha during multistage skin carcinogenesis in SENCAR mice. Mol. Carcinog. 11, 19–28 (1994).
Article PubMed CAS Google Scholar
Song, J. I. & Grandis, J. R. STAT signaling in head and neck cancer. Oncogene 19, 2489–2495 (2000).
Article PubMed CAS Google Scholar
Sano, S. et al. Signal transducer and activator of transcription 3 is a key regulator of keratinocyte survival and proliferation following UV irradiation. Cancer Res. 65, 5720–5729 (2005).
Article PubMed CAS Google Scholar
Kim, D. J., Chan, K. S., Sano, S. & Digiovanni, J. Signal transducer and activator of transcription 3 (Stat3) in epithelial carcinogenesis. Mol. Carcinog. 46, 725–731 (2007).
Article PubMed CAS Google Scholar
Lee, H., Morales, L. D., Slaga, T. J. & Kim, D. J. Activation of T-cell protein-tyrosine phosphatase suppresses keratinocyte survival and proliferation following UVB irradiation. J. Biol. Chem. 290, 13–24 (2015).
Article PubMed CAS Google Scholar
Lee, H. et al. Targeted disruption of TC-PTP in the proliferative compartment augments STAT3 and AKT signaling and skin tumor development. Sci. Rep. 7, 45077 (2017).
Article PubMed PubMed Central CAS Google Scholar
Koch, S. & Claesson-Welsh, L. Signal transduction by vascular endothelial growth factor receptors. Cold Spring Harb. Perspect. Med. 2, a006502 (2012).
Article PubMed PubMed Central CAS Google Scholar
Man, X. Y., Yang, X. H., Cai, S. Q., Yao, Y. G. & Zheng, M. Immunolocalization and expression of vascular endothelial growth factor receptors (VEGFRs) and neuropilins (NRPs) on keratinocytes in human epidermis. Mol. Med. 12, 127–136 (2006).
Article PubMed PubMed Central CAS Google Scholar
Yang, X. H. et al. Expression of VEGFR-2 on HaCaT cells is regulated by VEGF and plays an active role in mediating VEGF induced effects. Biochem. Biophys. Res. Commun. 349, 31–38 (2006).
Article PubMed CAS Google Scholar
Zhu, J. W. et al. Activation of VEGFR-2 signaling in response to moderate dose of ultraviolet B promotes survival of normal human keratinocytes. Int. J. Biochem. Cell. Biol. 44, 246–256 (2012).
Article PubMed CAS Google Scholar
Hsieh, S. H. et al. Galectin-1, a novel ligand of neuropilin-1, activates VEGFR-2 signaling and modulates the migration of vascular endothelial cells. Oncogene 27, 3746–3753 (2008).
Article PubMed CAS Google Scholar
Pedram, A., Razandi, M. & Levin, E. R. Extracellular signal-regulated protein kinase/Jun kinase cross-talk underlies vascular endothelial cell growth factor-induced endothelial cell proliferation. J. Biol. Chem. 273, 26722–26728 (1998).
Article PubMed CAS Google Scholar
Pearson, G. et al. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr. Rev. 22, 153–183 (2001).
PubMed CAS Google Scholar
Liu, J. & Lin, A. Role of JNK activation in apoptosis: a double-edged sword. Cell Res. 15, 36–42 (2005).
Article PubMed Google Scholar
Fuchs, S. Y., Adler, V., Pincus, M. R. & Ronai, Z. MEKK1/JNK signaling stabilizes and activatesp53. Proc. Natl Acad. Sci. USA 95, 10541–10546 (1998).
Article PubMed PubMed Central CAS Google Scholar
Zeke, A., Misheva, M., Remenyi, A. & Bogoyevitch, M. A. JNK signaling: regulation and functions based on complex protein-protein partnerships. Microbiol. Mol. Biol. Rev. 80, 793–835 (2016).
Article PubMed PubMed Central CAS Google Scholar
Tournier, C. et al. Requirement of JNK for stress-induced activation of the cytochrome c-mediated death pathway. Science 288, 870–874 (2000).
Article PubMed CAS Google Scholar
Liu, J., Minemoto, Y. & Lin, A. c-Jun N-terminal protein kinase 1 (JNK1), but not JNK2, is essential for tumor necrosis factor alpha-induced c-Jun kinase activation and apoptosis. Mol. Cell Biol. 24, 10844–10856 (2004).
Article PubMed PubMed Central CAS Google Scholar
Zhang, J. Y. & Selim, M. A. The role of the c-Jun N-terminal Kinase signaling pathway in skin cancer. Am. J. Cancer Res. 2, 691–698 (2012).
PubMed PubMed Central CAS Google Scholar
Lichti, U., Anders, J. & Yuspa, S. H. Isolation and short-term culture of primary keratinocytes, hair follicle populations and dermal cells from newborn mice and keratinocytes from adult mice for in vitro analysis and for grafting to immunodeficient mice. Nat. Protoc. 3, 799–810 (2008).
Article PubMed CAS Google Scholar
Szabo, A. Z. et al. The CD44+ALDH+ population of human keratinocytes is enriched for epidermal stem cells with long-term repopulating ability. Stem Cells 31, 786–799 (2013).
Article PubMed PubMed Central CAS Google Scholar
Mattila, E., Auvinen, K., Salmi, M. & Ivaska, J. The protein tyrosine phosphatase TCPTP controls VEGFR2 signalling. J. Cell Sci. 121, 3570–3580 (2008).
Article PubMed CAS Google Scholar
Simons, M., Gordon, E. & Claesson-Welsh, L. Mechanisms and regulation of endothelial VEGF receptor signalling. Nat. Rev. Mol. Cell Biol. 17, 611–625 (2016).
Article PubMed CAS Google Scholar
Abhinand, C. S., Raju, R., Soumya, S. J., Arya, P. S. & Sudhakaran, P. R. VEGF-A/VEGFR2 signaling network in endothelial cells relevant to angiogenesis. J. Cell Commun. Signal 10, 347–354 (2016).
Article PubMed PubMed Central Google Scholar
Assefa, Z. et al. Differential stimulation of ERK and JNK activities by ultraviolet B irradiation and epidermal growth factor in human keratinocytes. J. Invest. Dermatol. 108, 886–891 (1997).
Article PubMed CAS Google Scholar
Moriyama, M. et al. BNIP3 upregulation via stimulation of ERK and JNK activity is required for the protection of keratinocytes from UVB-induced apoptosis. Cell Death Dis. 8, e2576 (2017).
Article PubMed PubMed Central CAS Google Scholar
Tonks, N. K. Protein tyrosine phosphatases: from genes, to function, to disease. Nat. Rev. Mol. Cell Biol. 7, 833–846 (2006).
Article PubMed CAS Google Scholar
Kim, M., Baek, M. & Kim, D. J. Protein tyrosine signaling and its potential therapeutic implications in carcinogenesis. Curr. Pharm. Des. 23, 4226–4246 (2017).
PubMed CAS Google Scholar
Kim, M. et al. UVB-induced nuclear translocation of TC-PTP by AKT/14-3-3sigma axis inhibits keratinocyte survival and proliferation. Oncotarget 8, 90674–90692 (2017).
PubMed PubMed Central Google Scholar
Schaefer, L. K., Ren, Z., Fuller, G. N. & Schaefer, T. S. Constitutive activation of Stat3alpha in brain tumors: localization to tumor endothelial cells and activation by the endothelial tyrosine kinase receptor (VEGFR-2). Oncogene 21, 2058–2065 (2002).
Article PubMed CAS Google Scholar
Man, X. Y., Yang, X. H., Cai, S. Q., Bu, Z. Y. & Zheng, M. Overexpression of vascular endothelial growth factor (VEGF) receptors on keratinocytes in psoriasis: regulated by calcium independent of VEGF. J. Cell Mol. Med. 12, 649–660 (2008).
Article PubMed CAS Google Scholar
Dlugosz, A. A., Glick, A. B., Tennenbaum, T., Weinberg, W. C. & Yuspa, S. H. Isolation and utilization of epidermal keratinocytes for oncogene research. Methods Enzymol. 254, 3–20 (1995).
Article PubMed CAS Google Scholar
Campeau, E. et al. A versatile viral system for expression and depletion of proteins in mammalian cells. PLoS One 4, e6529 (2009).
Article PubMed PubMed Central CAS Google Scholar

Download references

Acknowledgements

We thank H Lee for technical assistance. This work was supported by NIH/NIEHS ES022250 (to D.J.K.) and NIH/NIAID AI119131 (to S.M.).

Authors’ contributions

D.J.K., M.B., and M.K. conceived the project, designed the study, and interpreted the results. S.M., S.W.-B., I.-S.J., and A.T.T. also contributed to interpretation of results. M.B., M.K., J.S.L., L.D.M., and J.H. performed the experiments. D.J.K. wrote the manuscript. All authors discussed the results and commented on the manuscript.

Author information

Minwoo Baek
Present address: College of Pharmacy, University of Minnesota, Duluth, MN, USA
These authors contributed equally: Minwoo Baek, Mihwa Kim, Jae Sung Lim

Authors and Affiliations

Department of Biomedical Sciences, School of Medicine, University of Texas Rio Grande Valley, Edinburg, TX, USA
Minwoo Baek, Mihwa Kim, Jae Sung Lim, Andrew T. Tsin & Dae Joon Kim
Department of Human Genetics, School of Medicine, University of Texas Rio Grande Valley, Edinburg, TX, USA
Liza D. Morales, Joselin Hernandez, Srinivas Mummidi, Sarah Williams-Blangero & Dae Joon Kim
South Texas Diabetes and Obesity Institute, School of Medicine, University of Texas Rio Grande Valley, Edinburg, TX, USA
Liza D. Morales, Joselin Hernandez, Srinivas Mummidi & Sarah Williams-Blangero
Division of Bioconvergence Analysis, Korea Basic Science Institute, Daejeon, 305-333, Republic of Korea
Ik-Soon Jang

Authors

Minwoo Baek
View author publications
You can also search for this author in PubMed Google Scholar
Mihwa Kim
View author publications
You can also search for this author in PubMed Google Scholar
Jae Sung Lim
View author publications
You can also search for this author in PubMed Google Scholar
Liza D. Morales
View author publications
You can also search for this author in PubMed Google Scholar
Joselin Hernandez
View author publications
You can also search for this author in PubMed Google Scholar
Srinivas Mummidi
View author publications
You can also search for this author in PubMed Google Scholar
Sarah Williams-Blangero
View author publications
You can also search for this author in PubMed Google Scholar
Ik-Soon Jang
View author publications
You can also search for this author in PubMed Google Scholar
Andrew T. Tsin
View author publications
You can also search for this author in PubMed Google Scholar
Dae Joon Kim
View author publications
You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Dae Joon Kim.

Ethics declarations

Conflict of interest

The authors declare that they have no conflict of interest.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Baek, M., Kim, M., Lim, J.S. et al. Epidermal-specific deletion of TC-PTP promotes UVB-induced epidermal cell survival through the regulation of Flk-1/JNK signaling. Cell Death Dis 9, 730 (2018). https://doi.org/10.1038/s41419-018-0781-9

Download citation

Received: 12 February 2018
Revised: 24 May 2018
Accepted: 04 June 2018
Published: 28 June 2018
DOI: https://doi.org/10.1038/s41419-018-0781-9
Springer Nature Limited

This article is cited by

Overexpression of TC-PTP in murine epidermis attenuates skin tumor formation
- Mihwa Kim
- Liza D. Morales
- Dae Joon Kim
Oncogene (2020)

Epidermal-specific deletion of TC-PTP promotes UVB-induced epidermal cell survival through the regulation of Flk-1/JNK signaling

Abstract

Similar content being viewed by others

Overexpression of TC-PTP in murine epidermis attenuates skin tumor formation

Targeted disruption of TC-PTP in the proliferative compartment augments STAT3 and AKT signaling and skin tumor development

Targeting PRPK and TOPK for skin cancer prevention and therapy

Introduction

JNK is a downstream signal of Flk-1 that is responsible for UVB-induced keratinocyte survival

Discussion

Materials and methods

TC-PTP knockout (K14Cre.Ptpn2 ^fl/fl) mice and UVB irradiation

Establishment of immortalized primary keratinocyte cell lines

Cell culture and UVB irradiation

Soft agar colony formation assay

Small interfering RNAs and inhibitors

Analysis of UVB-induced apoptosis in keratinocytes and epidermis

Cell viability assay

Establishment of the substrate-trap** mutant TC-PTP/D182A overexpressing stable cell lines

Immunoprecipitation

Preparation of protein lysates and western blot analysis

References

Acknowledgements

Authors’ contributions

Author information

Authors and Affiliations

Corresponding author

Ethics declarations

Conflict of interest

Additional information

Rights and permissions

About this article

Cite this article

This article is cited by

Overexpression of TC-PTP in murine epidermis attenuates skin tumor formation

Navigation

Epidermal-specific deletion of TC-PTP promotes UVB-induced epidermal cell survival through the regulation of Flk-1/JNK signaling

Abstract

Similar content being viewed by others

Overexpression of TC-PTP in murine epidermis attenuates skin tumor formation

Targeted disruption of TC-PTP in the proliferative compartment augments STAT3 and AKT signaling and skin tumor development

Targeting PRPK and TOPK for skin cancer prevention and therapy

Introduction

JNK is a downstream signal of Flk-1 that is responsible for UVB-induced keratinocyte survival

Discussion

Materials and methods

TC-PTP knockout (K14Cre.Ptpn2 fl/fl) mice and UVB irradiation

Establishment of immortalized primary keratinocyte cell lines

Cell culture and UVB irradiation

Soft agar colony formation assay

Small interfering RNAs and inhibitors

Analysis of UVB-induced apoptosis in keratinocytes and epidermis

Cell viability assay

Establishment of the substrate-trap** mutant TC-PTP/D182A overexpressing stable cell lines

Immunoprecipitation

Preparation of protein lysates and western blot analysis

References

Acknowledgements

Authors’ contributions

Author information

Authors and Affiliations

Corresponding author

Ethics declarations

Conflict of interest

Additional information

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Overexpression of TC-PTP in murine epidermis attenuates skin tumor formation

Search

Navigation

TC-PTP knockout (K14Cre.Ptpn2 ^fl/fl) mice and UVB irradiation