Introduction

Pyroptosis is a lytic form of programmed cell death, characterized by cytoplasmic swelling, pore formation in the cell membrane, and release of pro-inflammatory cytokines [1]. Pyroptosis is initiated in response to pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) via pattern recognition receptors (PRRs) [2]. Based on their location, PRRs are divided into membrane-bound PRRs and cytoplasmic PRRs. Toll-like receptors (TLRs) are transmembrane proteins that play important roles in the innate immune response [3]. For example, activation of the TLR4 receptor by gram-negative bacteria endotoxins, such as lipopolysaccharide (LPS), stimulates multiple signaling pathways in macrophages, including NF-κB, and the subsequent production of pro-inflammatory cytokines [3]. Unlike TLRs, the nucleotide-binding oligomerization domain-like receptors (NOD-like receptors, NLRs) recognize endogenous danger or stress responses, and form multiprotein complexes called inflammasomes [4,5,6]. NLR Family Pyrin Domain Containing 3 (NLRP3), NLR family CARD domain-containing protein 4 (NLRC4), NLR Family Pyrin Domain Containing 1 (NLRP1) and Absent In Melanoma 2 (AIM2) are the best characterized inflammasomes, and have been implicated in the pathogenesis of sepsis, atherosclerosis, and acute lung injury [4,5,6,7]. Stimulation of inflammasomes involves two signals: 1) transcriptional and posttranslational priming of inflammasome components, for example by LPS; and 2) activation of inflammasome assembly by a cell danger signal, such as K+ influx, extracellular ATP for NLRP3, or double-stranded DNA for AIM2. The formation of inflammasomes triggers the activation of caspase-1 and subsequent processing of interleukin-1β (IL-1β) and interleukin-18 (IL-18) into their mature forms [8, 9]. Gasdermin-D (GSDMD) was discovered as a pore-forming protein and the key effector downstream of caspase-1 activation. Active caspases cleave GSDMD to generate an N-terminal cleavage product (GSDMD-NT) that forms transmembrane pores to enable IL-1β release and to drive pyroptosis [10,11,12]. The importance of IL-1β as a disease mediator was confirmed by the CANTOS trial in which an IL-1β neutralizing antibody led to a lower rate of recurrent cardiovascular events in patients with previous myocardial infarction [13].

Recent data suggest that endogenous lipids or their oxidation products can activate or inhibit the assembly of inflammasomes [5, 14]. Among reactive aldehydes derived from lipid peroxidation, 4-hydroxynonenal (HNE) is the most abundant end-product. The concentration of HNE in human serum is 0.05–0.15 μM under physiological conditions [15]. However, HNE levels may reach 3–6 μM in tissues under oxidative stress [16, 17]. Because of its high solubility in aqueous fluids, the reactive HNE formed in membranes can diffuse into the cytoplasm. HNE is detoxified by conjugation to glutathione by glutathione S-transferase [18, 19]. However, some HNE molecules escape this mechanism and react with the side chains of cysteine, histidine and lysine residues in proteins [20,21,22]. HNE thus has emerged as an important second messenger signaling molecule [18, 19]. For example, low concentrations of HNE produce beneficial effects, including the stimulation of endogenous antioxidant defense mechanisms and the inhibition of inflammation [19, 23,24,25,26]. Currently, two mechanisms are proposed for HNE-mediated regulation of inflammation. (1) HNE facilitates antioxidant expression by activating Nrf2 signaling, via disrupting Keap1 − Nrf2 association and preventing Nrf 2 degradation [24, 25, 27]. Nrf2 stimulates antioxidant expression and increases the resistance to cytotoxic reactive oxygen species (ROS), thereby blocking multiple inflammatory pathways. (2) HNE blocks NF-κB activation by inhibiting IκB kinase (IKK) activity, likely by covalently modifying cysteine residue(s) of IKK [26, 28]. In this study we explored a novel mechanism by which the lipid peroxidation product HNE inhibits the NLRP3 inflammasome by directly disrupting the binding of NEK7 to NLRP3, thereby preventing activation of caspase-1. We demonstrate the importance of this pathway in decreasing inflammatory cytokine release and macrophage pyroptosis in vitro and in vivo.

Results

HNE inhibits pyroptotic cell death in human and mouse macrophages

Nigericin is a K+ ionophore that activates the NLRP3 inflammasome [29] and stimulates pyroptotic cell death. To study the role of HNE in pyroptosis, we used LPS co-incubated with HNE, followed by nigericin, in differentiated human THP-1 macrophages and mouse bone-marrow-derived macrophages (BMDMs). Cell death was confirmed by morphological changes, lactate dehydrogenase (LDH) release, and real-time nucleic acid staining (SYTOXTM). HNE treatment alone (3 µM) had no effect on cell death, but HNE significantly decreased the magnitude of LPS-nigericin stimulated cell death as indicated by membrane blebbing, LDH release, and nucleic acid staining in mouse and human macrophages (Fig. 1A–F). These results show that HNE protects macrophages from LPS/nigericin-mediated pyroptosis.

Fig. 1: HNE inhibits pyroptotic cell death in human and mouse macrophages.
figure 1

A–C THP-1 differentiated macrophages were stimulated with LPS (100 ng/mL) and co-incubated with HNE (3 μM) or vehicle (ethanol) for 3 h followed by 2 h of 6 μM nigericin (Nig) treatment. A Cell morphology, scale bar = 10 µm. B LDH cytotoxicity. C Cell death by SYTOXTM green. D–F Bone-marrow-derived macrophages (BMDMs) were stimulated with LPS (100 ng/mL) and co-incubated with HNE (3 μM) or vehicle (ethanol) for 3 h followed by 1 h of 2 μM nigericin (Nig) treatment. D Cell morphology, scale bar = 10 µm. E LDH cytotoxicity. F Cell death by SYTOXTM green. Statistics in B and E were performed using a 2-way ANOVA and Bonferroni’s post hoc test. ****P < 0.001 between LPS + Nig+ethanol and LPS + Nig+HNE groups. (N = 4 experiments). Bars represent mean ± SD.

Full size image

HNE inhibits pyroptosis independent of Nrf2 signaling

Nrf2, an antioxidant transcription factor, has been proposed to regulate NLRP3 inflammasome activation [30,31,32]. Nrf2 function is inhibited by Keap1, which binds Nrf2, facilitates its degradation, and prevents its nuclear translocation [33]. To study the potential role of Nrf2 in HNE inhibition of pyroptosis, we first showed that HNE (3 µM) induced Nrf2 activation in macrophages as indicated by its nuclear translocation (Fig. 2A, B), wherase LPS did not. We next studied the effect of HNE on Nrf2 regulated genes, such as glutamate-cysteine ligase catalytic subunit (GCLC) and ferroportin-1 (Fig. 2C, D) [34]. LPS treatment alone had no significant effect on any of these measurements (Fig. 2C, D). Simultaneous treatment with LPS and HNE significantly increased Nrf2 activation, compared to LPS alone (Fig. 2A–D). To determine if Nrf2 activation was required for HNE inhibition of pyroptosis, we blocked Nrf2 signaling using the specific inhibitor, ML385 [35] (Fig. S1A, B). We found that 3 µM HNE still prevented cell death in the presence of ML385 (Fig. 2E, F), suggesting that the protective effect of HNE against pyroptosis was independent of the Nrf2 pathway.

Fig. 2: HNE inhibits pyroptosis independent of Nrf2 signaling.
figure 2

A, B THP-1 macrophages were stimulated with or without LPS (100 ng/mL) and co-incubated with ethanol or 3 µM HNE for 3 h. A Nrf2 translocation was determined by immunofluorescence (scale bar: 10 µm), DAPI (blue), and Nrf2 (Green). B Nuclear to cytosolic Nrf2 intensity ratio was quantified by Image J. C, D Peritoneal macrophages were stimulated with or without LPS (100 ng/mL) and co-incubated with ethanol or 3 µM HNE for 3 h. Gene expression was analyzed by real-time PCR. C GCLC mRNA expression and (D) Ferroportin-1 mRNA expression were measured after normalizing to β-actin expression. E, F THP-1 macrophages were treated with LPS with or without 3 µM HNE or 2 µM ML385 for 3 h followed by 6 µM nigericin (Nig) to induce inflammasome activation. E Cell morphology, scale bar = 5 µm. F Cell death by SYTOXTM green. Statistics in B, C, and D were performed using a 2-way ANOVA and Bonferroni’s post hoc test. **P < 0.01, ****P < 0.001 between HNE and ethanol groups after LPS treatment. Bars represent mean ± SD.

Full size image

HNE inhibits inflammasome activation independently of NF-κB signaling

Activation of the inflammasome involves first the NF-κB dependent stimulation of NLRP3 expression, and then NLRP3 oligomerization promoted by a cell danger signal, such as K+ efflux or ATP [36]. We first focused on the role of HNE in NF-κB signaling by assessing p65 phosphorylation, p65 nuclear translocation, and IκB-α degradation, as well as the expression of TNF-α and NLRP3 in macrophages treated with LPS. In response to LPS (100 ng/mL), there was a 3-fold increase in nuclear translocation of p65 (Fig. 3A, B) and a 10-fold increase in phosphorylation of p65 (Fig. 3C). TNF-α and NLRP3 expression were induced after LPS treatment through the NF-κB pathway, but these measurements were not significantly affected by 3 µM HNE (Fig.3A–C, Fig. S2A, B). Similarly, there was no significant effect of HNE (0.3–3 µM) on NLRP3, pro-IL-1β, and IκB-α protein expression (Fig. 3D–F, and Fig. S2D). Interestingly, HNE significantly reduced pro-IL-1β gene expression (Fig. S2C), suggesting that longer treatment of HNE may affect pro-IL-1β protein expression. Inflammasome activation induced by nigericin triggers IL-1β cleavage in LPS-primed macrophages. To minimize the effects of HNE on NF-κB-dependent transcription, macrophages were treated with LPS for 3 h before exposure to HNE (Fig. S2E) and then stimulated with nigericin (Fig. 3G). We found HNE still significantly prevented IL-1β maturation (Fig. 3H). Furthermore, we performed the experiments where BMDMs were pre-treated with HNE for 30 min, and then stimulated with nigericin after 10 min LPS priming. NLRP3 activation was confirmed by the cleavage of caspase-1 and GSDMD. We found that rapid NLRP3 priming followed by nigericin treatment induced caspase-1 and GSDMD cleavage, and HNE pre-treatment inhibited these effects (Fig. S3). Thus, the inhibitory effect of HNE treatment on inflammasome activation is independent of the NF-κB pathway.

Fig. 3: HNE inhibits IL-1β cleavage independently of NF-κB signaling in macrophages.
figure 3

A, B THP-1 macrophages were stimulated with or without LPS (100 ng/mL) and co-incubated with ethanol or 3 µM HNE for 1 h. A NF-κB p65 translocation was measured by immunofluorescence (scale bar: 5 µm), DAPI (blue), and p65 (Green). B Quantification using Image J. N = 3 experiments. C–E Peritoneal macrophages were stimulated with or without LPS (100 ng/mL) and co-incubated with ethanol or HNE (0.3-3 µM) for 3 h. Protein expression was analyzed by western blot. C Phosphorylation of p65, D NLRP3, E Pro-IL-1β. Bars represent mean ± SEM. N = 3 experiments. F Peritoneal macrophages were stimulated with LPS (100 ng/mL) and co-incubated with ethanol or HNE (3 µM) for 1or 3 h. Cell lysates were analyzed by western blot. F NLRP3, IκB-α, and β-actin western blots are representative of three independent experiments. G Schematic of experimental design for data in Fig. 3H. H BMDMs were stimulated with LPS (100 ng/mL) for 3 h followed by 6 µM nigericin (Nig) for 30 min. 3 µM HNE or ethanol was added 30 min before nigericin. Western blots (NLRP3, p65 phosphorylation, β-actin, pro-IL-1β, and cleaved IL-1β) are representative of three independent experiments. Statistics in B were performed using a 2-way ANOVA and Bonferroni’s post hoc test. Statistics in C–E were performed using a one-way ANOVA and Bonferroni’s post hoc test. N = 3 experiments. A p-value less than 0.05 is statistically significant among treatment groups. Bars represent mean ± SD.

Full size image

HNE inhibits NLRP3 inflammasome activation, but has no effect on AIM2 or NLRC4

We next studied the effect of HNE on inflammasome assembly and activation. It has been suggested that NLRP3 and apoptosis-associated speck-like (ASC) proteins are assembled by acetylated α-tubulin-mediated transport to the microtubule organizing center (MTOC) [37]. Upon inflammasome activation by nigericin stimulated potassium efflux, we found increased α-tubulin acetylation in LPS primed peritoneal macrophages (Fig. 4A), BMDMs (Fig. S4A), and THP1 macrophages (Fig. S4B). However, HNE had no effect on acetylation of α-tubulin in these cells (Fig. 4A and Fig. S4A, B). These data suggest that acetylated α-tubulin was not involved in HNE inhibition of pyroptosis.

Fig. 4: HNE inhibits NLRP3 inflammasome activation.
figure 4

A–F HNE (3 µM) or ethanol was added 30 min before nigericin, ATP, or poly(dA:dT) treatment. A Peritoneal macrophages were stimulated with LPS (100 ng/mL) for 3 h followed by 2 µM nigericin (Nig). Acetyl-α-Tubulin (Lys40) western blots are representative of three independent experiments. B Peritoneal macrophages. C Human PBMC were stimulated with LPS (100 ng/mL) for 3 h followed by 2 µM nigericin (Nig) or ATP (2 mM) stimulation for 1 h. IL-1β in the medium was measured by ELISA. Bars represent mean ± SD. D THP-1 macrophages that overexpressed ASC-GFP were stimulated with LPS (100 ng/mL) followed by 6 µM nigericin (Nig) for 2 h. ASC speck formation (arrows) was measured by confocal microscopy. (scale bar: 10 µm). Quantification results were shown at lower magnification images in Fig. S6. E THP-1 macrophages were stimulated with LPS (100 ng/mL) for 3 h followed by 6 µM nigericin (Nig) for 2 h. ASC oligomerization western blots are representative of three independent experiments. F Peritoneal macrophages were stimulated with LPS (100 ng/mL) for 3 h followed by 2 µM nigericin (Nig) or ATP (2 mM) stimulation for 15 min. Western blots are representative of three independent experiments. G Peritoneal macrophages were stimulated with LPS (100 ng/mL) for 3 h followed by 2 µg/mL Poly(dA:dT) for 6 h. Ethanol or 3 µM HNE was co-incubated with cells 30 min before Poly(dA:dT). Western blots are representative of three independent experiments. H THP-1 macrophages were stimulated with LPS (100 ng/mL) for 3 h followed by 2 µg/mL Poly(dA:dT) for 6 h. IL-1β in the medium was measured by ELISA. Statistics in B, C, and H were performed using a 2-way ANOVA and Bonferroni’s post hoc test. ****P < 0.001 between control and treatment groups. Bars represent mean ± SD.

Full size image

To analyze the effects of HNE more broadly, we used ATP as a second signal to induce inflammasome activation (Fig. 4B, C). We also studied both peripheral blood mononuclear cells (PBMC) from healthy human donors, and peritoneal macrophages from mice. We confirmed that HNE inhibited IL-1β release (Fig. 4B, C). Next, the effect of HNE on a non-potassium efflux dependent NLRP3 stimulus was tested. THP-1 macrophages were stimulated with LPS for 3 h followed by R837 (Imiquimod) for 1 h. We found that HNE reduced IL-1β secretion (Fig. S5). These data indicated that HNE also inhibits non-potassium efflux-mediated NLRP3 activation.

Upon NLRP3 inflammasome activation, the adaptor protein ASC is recruited by NLRP3 and forms large multimeric complexes, termed ASC specks [38]. To determine the effect of HNE on ASC speck formation, we overexpressed an ASC-GFP fusion protein in THP-1-differentiated macrophages and stimulated them with LPS followed by nigericin. HNE treatment inhibited ASC speck formation, as indicated by reduced ASC speck immunofluorescence (Fig. 4D, and Fig. S6A, B). Similarly, HNE reduced large multimeric ASC complexes, as detected by western blot (Fig. 4E).

Inflammasome activation leads to the cleavage of pro-caspase-1 to generate active caspase-1 that cleaves gasdermin-D (GSDMD) to form membrane pores, which enables the release of cytokines, such as IL-1β. Therefore, we measured the effect of HNE on these parameters of inflammasome activation (Fig. 4F). LPS primed peritoneal macrophages were treated with HNE followed by nigericin or ATP. The inhibitory effect of HNE on NLRP3 activation was confirmed by western blot as shown by decreased cleavage of caspase-1, GSDMD, and IL-1β to their mature p20, p30, and p17 forms, respectively (Fig. 4F).

NLRP3, AIM2, and NLRC4 inflammasomes respond to different ligands or activators, but all engage with the adaptor protein ASC and activate protein caspase-1 to cleave pro-IL-1β. To study the specificity of HNE for the NLRP3 inflammasome, we tested the effect of HNE on the AIM2 and NLRC4 inflammasome. AIM2 is activated by cytosolic double-stranded DNA (dsDNA). NLRC4 is activated by cytosolic flagellin. To determine the effect of HNE on these two inflammasomes, macrophages were treated with LPS for 3 h, then HNE for 30 min, then transfection with poly(dA:dT) or flagellin for 6 h and 3 h, respectively. In contrast to the NLRP3 inflammasome, HNE did not reduce cleavage of caspase-1 or IL-1β release after AIM2 inflammasome activation (Fig. 4G, H). Similarly, HNE did not reduce IL-1β release after NLRC4 inflammasome activation (Fig. S7). Together, these data show that HNE inhibits NLRP3 assembly and activation in mouse and human cells, but has no effect on AIM2 and NLRC4.

HNE reduces non-canonical inflammasome-mediated IL-1β release, but has no effect on GSDMD-mediated cell death

Non-canonical inflammasome activation is dependent on caspase-11 (in mice) or caspase-4 (in humans) which directly bind with intracellular LPS [39, 40]. Recent data suggest that the non-canonical inflammasome pathways play critical roles in acute lung injury and sepsis by sensing cytosolic LPS [Human peripheral blood mononuclear cells (PBMC) isolation

PBMC isolation was performed as previously described [85]. Whole blood (20 mL) was layered upon a 15 mL Ficoll-Paque cushion (GE Healthcare, 17-1440-02) in 50 mL conical tubes, and centrifuged for 40 min at 400 x g at room temperature with the brake off. The layer of mononuclear cells at the plasma-density gradient medium interface was transferred to a new 50 mL conical tube, and 1x PBS was added to 45 ml total volume. Cells were centrifuged for 10 min at 2000 x g at room temperature and the remaining pellet of mononuclear cells was resuspended in complete RPMI medium at 1.6 × 105 cells/well in 12-well plates for future experiments.

THP-1 macrophage differentiation

Human THP-1 monocytes were differentiated into macrophages by 24 h incubation with 100 nM PMA (Sigma-Aldrich) in complete RPMI medium at 1.6 × 105 cells/well in 12-well plates. Cells were washed twice with 1x PBS and incubated with complete RPMI medium without PMA for 24 h before experiment.

ASC-GFP-overexpressed THP-1 macrophage

A lentivirus expressing the ASC-GFP fusion protein was prepared by transfection of pLEX-MCS-ASC-GFP (Addgene 73957), psPAX2, and p MD.2 G using Fugene 6 (Promega, PAE2693) in HEK293T cells. Culture medium was replaced after 24 h with fresh medium containing 5% FBS After a further 48 h virus containing medium was collected and stored in −80 °C. THP-1 monocytes at 1.6 × 105 cells/well on 12-well plates were infected with 400 uL virus with polybrene (4 µg/ml) and centrifuged at 2500 rpm at 20 oC for 90 min. Fresh complete RPMI medium with 100 nM PMA was added and followed by 24 h incubation. Cells were washed twice with 1x PBS and incubated with complete RPMI medium without PMA for 24 h before experiment.

Overexpressed GSDMD-NT HEK293T cells

FLAG-GSDMD-NT (80951) and FLAG-GSDMD-NT-C192A (133891) were obtained from Addgene. HEK293T cells were cultured in complete DMEM medium containing 10% FBS and 1% Penicillin/Streptomycin. Transient transfection of HEK293T cells was performed using Fugene6 (Promega) according to the manufacturer’s instructions.

HEK293As overexpressed with NLRP3, NEK7, and ASC-GFP

HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957) were established under G418 (1 mg/ml) and puromycin (1 µg/ml) selection following transfection with Fugene6. NEK7 (Addgene 75142) was expressed in the stable cell line by transient transfection using Fugene6 for 48 h. Cell extracts were prepared after LPS/Nigericin treatment with or without HNE for 30 min.

LPS stimulation

Macrophage cultures were rinsed twice with serum and antibiotic-free medium (RPMI 1640 for peritoneal macrophages, THP-1 macrophages, and PBMCs or DMEM medium for BMDMs). Cells were exposed to LPS (100 ng/mL) for 3 h with ethanol or HNE (0.3–3 µM, Millipore Sigma, 393204) in appropriate growth media. For time-course studies, individual wells were exposed to LPS (100 ng/mL) for different times, but to minimize manipulation of each plate, the total incubation time was 3 h for all treatments.

Inflammasome stimulation

To activate the NLRP3 inflammasome, cells were primed for 3 h with LPS (100 ng/mL) followed by addition of 2 µM (BMDMs, peritoneal macrophages, PBMCs), 6 µM (THP-1 differentiated macrophages) nigericin (Sigma-Aldrich, N7143-5MG), 2 mM (peritoneal macrophages) ATP or 50 µM (THP-1 differentiated macrophages) R837 (InvivoGen, tlrl-imqs) for 30–60 min. To activate the AIM2 inflammasome, THP-1 macrophages or peritoneal macrophages were primed with LPS (100 ng/mL) for 3 h followed by (Poly(dA:dT), 2 µg/mL) for 6 h using LyoVecTM (InvivoGen, tlrl-patc) according to the manufacturer’s protocol. To activate the NLRC4 inflammasome, BMDMs were primed with LPS (100 ng/mL) for 3 h followed by (flagellin isolated from P. aeruginosa, 2 or 5 µg/mL) for 3 h using FLA-PA Ultrapure (InvivoGen, tlrl-pafla) according to the manufacturer’s protocol. To activate the non-canonical inflammasome, peritoneal macrophages were stimulated with LPS (100 ng/mL) for 3 h followed by intracellular LPS delivery (1 µg/mL) by transfection using lipofectamine 2000 (Invitrogen, 11668027), according to the manufacturer’s protocol, in OptiMEM (Gibco, 31985-070) for 16 h. HNE (0.3–10 µM) (Millipore Sigma, 393204), alkyne-HNE (1–20 µM) (Cayman Chemical, 13265) or HNE-GSH (3–10 µM) (Cayman Chemical Company, 10627) was added 30 min before the inflammasome activator.

Cell morphology

Micrographs of cell cultures were obtained under phase contrast illumination using 40X objective (Leica) prior to cell lysis. Multiple random fields were captured for each well.

Cell death LDH assay

Culture supernatants were collected and centrifuged at 500 × g for 5 min to remove cellular debris. LDH measurement was performed with the CyQUANT™ LDH cytotoxicity assay kit (Thermo Fisher Scientific, C20301) according to the manufacturer’s instructions. Data were plotted normalizing the O.D. value obtained in wells treated with Triton X-100 (0.1%) as 100%.

Cell death by SYTOXTM green

THP-1 macrophages or BMDMs were seeded in 96-well plates (2 × 104 cells/well) one day before the experiments. Cells were washed twice and incubated with LPS (100 ng/mL) in XF based medium (Agilent, 103334-100) supplemented with 4.5 g/L glucose, 2 mM glutamine, 1 mM sodium pyruvate, and 1 mM HEPES buffer at final pH7.4 for 3 h. After 3 h LPS stimulation, SYTOX Green (final concentration 1 µM) (Thermo Fisher Scientific, S7020) was added together with nigericin (2 µM for BMDMs; 6 µM for THP-1 macrophages) and fluorescence signals (Excitation wavelength: 485 nm, Emission wavelength: 550 nm) were analyzed using FLUOstar OPTIMA plate reader (BMG Labtech) at 36 oC for 120 min. The percentage cell death was calculated by normalizing fluorescence signals from cells treated with Triton X-100 (0.1%).

Nuclear translocation of Nrf2 and p65

Nrf2 or NF-κB p65 nuclear translocation was measured by immunofluorescence staining. THP-1 monocytes were seeded on glass coverslips in 12- well plates and differentiated as described above. Cells were treated with LPS (Nrf2 for 3 h; p65 for 1 h) and were washed twice with cold PBS and fixed with 4% formaldehyde in PBS for 10 min. After washing with PBS, the cells were incubated with blocking solution (10% normal goat serum, and 0.1% Triton X-100 in PBS) for 1 h followed by incubating with the Nrf2 (Abcam, ab31163) 1:500; NF-κB p65 (D14E12) (Cell Signaling Technology, 8242) 1:500; antibody overnight. Cells were washed three times with PBS and incubated with the goat anti-rabbit IgG (H + L) secondary antibody, alexa fluor 488 (Thermo Fisher Scientific, A-11034) for 1 h in PBS in the dark. After three washes with PBS, samples were mounted using fluoromount-G-DAPI (SouthernBiotech, 0100-20). Immunofluorescence was analyzed by confocal microscopy. Nuclear translocation was evaluated using NIH ImageJ software with an intensity ratio nuclei cytoplasm macro. Quantification of translocation was expressed as the percentage of intensity in nucleus over total cell [86]. The data points shown are from 3 separate experiments with duplicate or triplicate wells. Around 200 cells from at least 6 images were quantified for each experimental group.

Cytokine and HNE assays

Plasma, BAL fluid and peritoneal fluid levels of IL-1 β (Invitrogen 88-7013-22), IL-18 (Invitrogen, BMS618-3) and TNF-α (BioLegend, 430904) collected from mouse studies were determined by ELISA kits according to the manufacturer’s instructions. For in vitro studies, culture media was collected immediately after treatment. Samples were cleared by centrifugation at 16,000 ×g for 5 min and stored at −20 °C. HNE (MyBioSource.com, MBS7606509), Human and mouse IL-1 β (BioLegend, 437004 and 432604) were measured in culture supernatants by ELISA.

RNA extraction and Real-time PCR

RNA was extracted from lung tissue or cultured cells using RNeasy kit (Qiagen, 74106) according to the manufacturer’s instructions. Complementary DNA was synthesized from 0.5 μg RNA by iScript™ cDNA Synthesis Kit (Bio-Rad, 1708891). Amplification reactions contained a target specific fraction of cDNA and 1 μM forward and reverse primers in iQ™ SYBR® Green Supermix (Bio-Rad, 1708882). Fluorescence was monitored and analyzed in a CFX connect real-time PCR system (Bio-Rad). Gene expression was normalized to β-actin using the delta delta cycle threshold method. Amplification of specific transcripts was confirmed by melting curve analysis at the end of each PCR experiment. The primers used are as follows: Mouse GCLC (Forward: AGATGATAGAACACGGGAGGAG, Reverse: TGATCCTAAAGCGATTGTTCTTC); Mouse Ferroportin-1(Forward: ACCCATCCCCATAGTCTCTGT, Reverse: ACCGTCAAATCAAAGGACCA); Mouse β-actin (Forward: TTCAACACCCCAGCCATGT, Reverse: GTAGATGGGCACAGTGTGGGT); Mouse IL-1β(Forward: GAGTGTGGATCCCAAGCAAT, Reverse: ACGGATTCCATGGTGAAGTC); Mouse IL-6 (Forward: GAGGATACCACTCCCAACAGACC, Reverse: AAGTGCATCATCGTTGTTCATACA); Mouse TNF-α (Forward: TCTTCTCATTCCTGCTTGTGG, Reverse: GGTCTGGGCCATAGAACTGA); Mouse NLRP3 (Forward: TTCCCAGACACTCATGTTGC, Reverse: AGAAGAGACCACGGCAGAAG); SAA3 (Forward: TTTCTCTTCCTGTTGTTCCCAGTC, Reverse: TCACAAGTATTTATTCAGCACATTGGGA).

Western blot

Proteins were separated by SDS-PAGE through 10% acrylamide gels and transferred to nitrocellulose membranes, blocked with 5% nonfat dry milk in Tween-TBS and reacted with the indicated antibody: NLRP3 (AdipoGen, AG-20B-0014-C100) 1:1000; Caspase-1(AdipoGen, AG-20B-0042-C100) 1:1000; GSDMD (Abcam, ab209845) 1:1000; IL-1β (GeneTex, GTX10750) 1:2000; ASC (Santa Cruz Biotechnology, sc-514414) 1:1000; GAPDH (Millipore, MAB374) 1:2000 β-actin (Cell Signaling Technology, 4970) 1:4000; Phospho-NF-κB p65 (Ser536) (93H1) (Cell Signaling Technology, 3033 S) 1:1000; IκB-α (L35A5) (Cell Signaling Technology, 4814) 1:1000; Acetyl-α-Tubulin (Lys40) (5335 T) 1:1000; NEK7 (Abcam, ab133514) 1:1000 overnight. Membranes were rinsed and incubated with horseradish peroxidase conjugated secondary antibody (Anti-mouse IgG, HRP-linked Antibody (Cell Signaling Technology, 7076), Anti-rabbit IgG, HRP-linked Antibody (Cell Signaling Technology, 7074), Anti-goat IgG, HRP-linked Antibody (Jackson Immuno Research, 805-035-180). Reactive proteins were detected by enhanced chemiluminescence, visualized by exposure to radiographic film and quantified by scanning densitometry normalized to β-actin expression measured in each sample on the same gel. All of the full and uncropped western blots were listed in supplemental material.

ASC speck formation

ASC-GFP-expressing THP-1differentiated macrophages were seeded on glass coverslips in 12- well plates. Cells were incubated with 100 ng/ml LPS for 3 h followed by incubation with 6 µM nigericin for 2 h. Cells were fixed in 4% paraformaldehyde for 10 min. After three washes with 1x PBS, cells were mounted using fluoromount-G-DAPI. Immunofluorescence was analyzed by confocal microscope. The GFP 488 nm fluorescent signals were acquired by confocal microscopy. The data points represent biological replicates from 3 separate experiments. Around 200 cells from at least 6 images were quantified for each experimental group.

ASC oligomerization

For ASC oligomer cross-linking, cells were lysed in buffer (0.5% Triton × 100, 20 mM HEPES-KOH, pH 7.5, 150 mM KCl, and complete protease and phosphatase inhibitor cocktail) on ice by syringing 10 times through a G26 needle. The cell lysates were centrifuged at 6000 rpm at 4 °C for 10 min. The pellets were resuspended in PBS and crosslinked with 2 mM disuccinimidyl suberate (Thermo Fisher Scientific, 21655). The cross-linked pellets were centrifuged at 15000 rpm for 15 min and dissolved directly in a 1x SDS sample buffer.

MitoSOX red imaging

THP-1differentiated macrophages were seeded on glass coverslips in 12- well plates. Cells were incubated with 100 ng/ml LPS for 3 h followed by incubation with 2 µM Mitosox red (Thermo Fisher Scientific, M36008) for 30 min. Cells were washed twice with medium and stimulated with nigericin for 1 h. Cells were fixed in 4% paraformaldehyde for 10 min. After three washes with 1x PBS, cells were mounted using fluoromount-G-DAPI. Immunofluorescence was analyzed by confocal microscope. The 510/580 nm fluorescent signals were acquired by confocal microscopy.

Click chemistry and biotin affinity precipitation

Cells were lysed in IP Lysis buffer (20 mM HEPES-KOH, 150 mM NaCl, and 0.5% v/v Triton-100x) containing protease inhibitor cocktail, and treated with 10 mM sodium borohydride (Sigma-Aldrich, 452882) for 30 min. Click-chemistry was performed with Molecular Probes Click iT Protein Reaction Buffer Kit (Thermo Fisher Scientific, C10276) according to the manufacturer’s instructions. Briefly, The Cu(I)-catalyzed click reaction was initiated by adding Click-iT reaction buffer and 50 µl of Azide-PEG3-biotin in 50 mM (Cayman Chemical, 23419) to each sample and incubated on a rotator for 20 min at room temperature. Protein was precipitated and the pellet was washed once with 100 µl of ice-cold methanol and centrifuged at 15,000 x g for 5 min. Methanol was removed and the pellets were re-suspended in 50 µl IP Lysis buffer containing protease inhibitor cocktail. Protein concentrations were estimated assuming no protein loss occurred during the click and precipitation procedure. To perform biotin affinity precipitation, clicked lysates were loaded with 20 µl of Dynabeads™ MyOne™ Streptavidin C1 (Invitrogen, 65001). The Dynabeads were equilibrated to buffer by three 100 µl washes. Thirty micrograms of “clicked” lysates were loaded onto the equilibrated beads. The volume was brought up to 100 µl with IP lysis buffer, and lysates were incubated with beads for 1 h at room temperature on a rotator. After incubation, the beads were washed six times with 100 µl volumes of IP lysis buffer. The bound proteins were eluted using 100 µl of 1X sample lysis buffer, by vortexing and heating at 95 °C for 10 min. The supernatant was collected and stored at −20 °C for western blot analysis.

Co-immunoprecipitation

Cells were lysed in IP buffer on ice by syringing 10 times through a G26 needle. The supernatant was collected as the whole cell lysate (WCL) sample. One mg total protein from WCL was incubated with anti-NEK7 antibody (Abcam, ab133514), anti-NLRP3 antibody (AdipoGen, AG-20B-0014-C100), ChromPure Rabbit IgG (Jackson Immuno Research, 011-000-003), or ChromPure Mouse IgG (Jackson Immuno Research, 015-000-00) overnight. Agarose beads (Roche, C755B62) was added to the remaining supernatant, which was subsequently incubated at 4 oC in a ferris wheel mixer for 3 h. IP samples were subsequently centrifuged at 200 x g for 2 min at 4 oC, supernatant removed, and beads washed five times with 1 mL low stringency lysis buffer. The immune complexes were eluted by addition of 100 µL of 1X sample lysis buffer, boiled for 5 min and analyzed by western blot.

Statistics

Unless otherwise noted, in vitro experiments were repeated as three independent procedures, with duplicate or triplicate wells averaged prior to statistical analysis. All data were presented as mean ± SD. GraphPad Prism 8.0 was used for statistical analysis. Comparisons between two groups after stimulation were analyzed by two-way ANOVA. HNE dose response experiments in cell cultures were analyzed by one-way ANOVA followed by post hoc T tests using Bonferroni correction for multiple comparisons. P values were indicated as follow: * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001.