Introduction

HCC is one of the most common types of all cancers worldwide, and is the fifth most common cancer among men and the ninth most common cancer among women [1, 2]. Globally, HCC is the third leading cause of cancer-related deaths [3]. Although it is commonly recognized that HCC is caused by a combination of genetic, immunologic, and environmental factors, its complete etiology has not been fully understood.

CD147, as well as basigin (BSG), is a transmembrane glycoprotein which regulates the level of matrix metalloproteinase (MMPs) through cell–matrix and cell–cell interaction. Previous work on CD147 have indicated that CD147 is involved in a variety of pathophysiological functions [In silico analyses

MirSNP (http://cmbi.bjmu.edu.cn/mirsnp), a database of polymorphisms predicting miRNA–mRNA binding sites, identifies miRNA-related SNPs in GWAS SNPs and eQTLs [19]. Apart from this, we analyzed the miRNA binding sites in CD147 3′-UTR using miRBase (http://www.mirbase.org/index.shtml) and TargetScan (http://www.targetscan.org/). With these bioinformatics tools, we identified hsa-miR-3976 potentially binding to a stretch of sequence harboring the rs6757. Subsequently, we utilized RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybird) to predict the miRNA-target binding structures and energies.

Plasmid construction and luciferase assay

The TT genotype of rs6757 was amplified by PCR using CD147-TT-F: 5′-ccgctcgagGGCAGGTGGCCCGAGGACGC-3′ and CD147-TT-R: 5′-ataagaatgcggccgcGAGGGTGGAGGTGGGGGCGA-3′, which were tagged with the XhoI and NotI restriction enzyme sites (underlined) respectively. The rs6757 TT genotype inserts were digested by XhoI/NotI, gel-purified, extracted, and then subcloned into the XhoI/NotI site of pSICHECK2 vector (Promega). The prepared plasmid was designated as CD147-TT-pSICHECK2. The inserts were sequenced to verify the validity and orientation relative to the luciferase gene at Genomic Company (Shenggong Biological Engineering Co, Shanghai, China). Using the site-directed mutagenesis, we constructed CD147-CC-pSICHEC-K2 that contains rs6757 CC genotype sequence by using CD147-CC-F: 5′-GAGGACGGCCGGCTCTCCATAGCACCAGGGCTCACGTGG-3′, and CD147-CC-R: 5′-CCACGTGAGCCCTGGTGCTATGGAGAGCCGGCCGTCCTC-3′ primers. The inserts of CD147-CC-pSICHECK2 were also confirmed by sequencing.

Cell culture

HEK293T cells (from Shenggong Biological Engineering Co.) were cultured with high-sugar DMEM medium containing 10% fetal bovine serum at 37 °C in humidified 5% CO2.

Transfection and luciferase assay

2 × 104 cells per well were seeded in 96-multiwell plates. After the cells reached 50–60% confluence, we used Lipofectamine 2000 reagent (Invitrogen) to transfect the prepared CD147-TT-pSICHECK2 or CD147-CC-pSICHECK2 (500 ng), 50 nmol/L hsa-miR-3976 mimics, hsa-miR-3976 control (as a control for hsa-miR-3976, the specific sequence is: UCACAACCUCCUAGAAAGAGUAGA), 100 nmol/L hsa-miR-3976 inhibitor (reverse sequence of hsa-miR-3976), and 100 nmol/L hsa-miR-3976 negative control (as a control for hsa-miR-3976 inhibitor, the specific sequence is UUUGUACUACACACAAAAGUACUG) into the cells. Over and above these, various concentrations (1.0, 2.5, 5.0, and 10 nM) of hsa-miR-3976 mimics were added to the transfection system to observe the effect of hsa-miR-3976 on luciferase activity at different concentrations. Each transfection was carried out in triplicate. The data were analyzed by normalizing firefly luciferase activity with that of the Renilla luciferase.

Statistical analysis

Continuous variables were compared using an unpaired t-test. The differences of alleles and genotypes frequency distribution between the groups were statistically analyzed using the χ2 test. The Hardy–Weinberg equilibrium (HWE) was tested by a Q test with one degree of freedom [14, 15]. The association between CD147 rs6757 and the risk of HCC was estimated using the odds ratio (OR) and the 95% confidence interval (CI). After adjustment for age, gender, smoking, and drinking, adjusted ORs and 95% CIs were calculated by logistic regression. The value of relative luciferase activity were presented as means ± SD and analyzed by Student’s t test. All statistics were performed by SPSS software version 19.0 and Stata software version 11.0. It was considered to be statistically significant when P < 0.05.

Results

A total of 155 HCC patients and 151 controls were enrolled in this study. There were significant differences in gender, age, and drinking status between HCC patients and controls. However, no significant difference was found regarding smoking (Table 1).

Table 1 Baseline characteristics of the HCC and control group
Full size table

Association of the CD147 rs6757:T>C with HCC susceptibility

The T/C variant (rs6757) was genotyped by sequencing in all 306 participants (Table 2). As shown in Table 2, the frequencies of the rs6757 genotypes and alleles between the HCC patients and controls were statistically significant (χ2 = 10.721, p = 0.005; χ2 = 10.364, p = 0.001). The distributions of genotypes in controls and HCC patients were compatible with HWE (PControls = 0.558, PHCC = 0.351). The detailed results are shown in Table 3. After adjusting for confounding factors including age, gender, smoking, and drinking, significant associations between the T/C variant (rs6757) and the risk of HCC were detected in C vs. T (OR = 1.826, 95% CI [1.263–2.642]), CC vs. TT (OR = 4.513, 95% CI [1.510–13.489]), dominant genetic model (OR = 1.824, 95% CI [1.122–2.965]), and recessive genetic model (OR = 3.765, 95% CI [1.286–11.020]). C variant (rs6757) was considered to be an independent risk factor for HCC. The detailed results are shown in Table 4.

Table 2 The distribution of CD147 rs6757 in HCC and control group
Full size table
Table 3 The HWE of CD147 rs6757 genotypes
Full size table
Table 4 The association between the rs6757 and risk of HCC
Full size table

Rs6757 is located in the predicted binding sites of hsa-miR-3976 in the CD147 3′-UTR

With the development of bioinformatics, there are more and more websites or software tools for predicting miRNA target genes online. Through integrating and analyzing the prediction results of different websites or software such as MirSNP (http://cmbi.bjmu.edu.cn/mirsnp), miRBase (http://www.mirbase.org/index.shtml), and TargetScan, we found that there were multiple potential miRNAs in the CD147 3′-UTR region. After intersecting these predicted results and comparing them in the NCBI database, we found that the rs6757 was exactly located in the seed region of has-miR-3976 (Fig. 1).

Fig. 1
figure 1

Combination of different alleles of rs6757 to hsa-miR-3976. The T/C variant (rs6757) is located in the seed region of miRNA-3976, which means that the C/T variant (rs6757) has the potential to disrupt the binding of miR-3976 to CD147 3′-UTR

Full size image

The forecasted minimal folding energies of the hsa-miR-3976 target duplexes for the rs6757-T and -C alleles were − 24.7 kcal/mol and − 20.2 kcal/mol respectively (Fig. 2). Obviously, the minimal folding energies of the duplexes rs6757-T-containing (− 24.7 kcal/mol) is lower than that of the duplexes rs6757-C-containing (− 20.2 kcal/mol). The lower minimal folding energies, the more stable binding of hsa-miR-3976 to the CD147 3′-UTR, which indicated more efficient translational repression for the CD147 transcript containing rs6757 T variant. The predicted sum of the ΔΔG value was 4.5 kcal/mol, which suggested that the rs6757 was more likely to be a functional SNP.

Fig. 2
figure 2

In silico analysis of the pairing of miR-3976 to the binding site in the 3′-UTR of CD147. The arrow indicates the SNP site in the CD147 3′-UTR in each folding structure. The lower minimal folding energies, the more stable binding; the higher the sum of the ΔΔG value, the more likely to be a functional SNP

Full size image

Functional analyses of rs6757

In order to detect whether the T/C variant (rs6757) affected the CD147 translational regulation by affecting the binding of miR-3976 to CD147 3′-UTR, we constructed the luciferase reporter vectors containing rs6757 different genotypes (Figs. 3, 4, 5, and 6). Luciferase expression was significantly reduced following transfection with CD147-TT-pSICHECK2 (P < 0.05); this translational suppression of miR-3976 can be reversed by its inhibitor (Fig. 7A). However, there was no significant statistical difference between the groups following transfection with CD147-CC-pSICHECK2 (Fig. 7B). Not only so, miR-3976 dose-dependently reduced the luciferase expression when cotransfected with constructs with the CD147-TT-pSICHECK2 (Fig. 7C). However, miR-3976 showed no effect on the luciferase expression when cotransfected with constructs with the CD147-CC-pSICHECK2 (Fig. 7C).

Fig. 3
figure 3

Sequencing results of the inserts in CD147-TT-pSICHECK2 plasmid. Arrows indicate the inserted rs6757 TT genotype fragment

Full size image
Fig. 4
figure 4

The Blast of the inserts in CD147-TT-pSICHECK2 plasmid. The sequencing results were analyzed by Blast, the inserted sequence of target gene was 100% consistent with the sequence of CD147 rs6757 TT genotype in the NCBI database

Full size image
Fig. 5
figure 5

Sequencing results of the inserts in CD147-CC-pSICHECK2 plasmid. The sequencing result showed that the mutation from nucleotide T to C at the target site (marked in green) of CD147 gene had successfully achieved

Full size image
Fig. 6
figure 6

The Blast of the inserts in CD147-CC-pSICHECK2 plasmid. After mutating from nucleotide T to C, the inserted sequence was 99% consistent with the sequence of CD147 in the NCBI database by Blast analysis

Full size image
Fig. 7
figure 7

The R/F analysis of a luciferase reporter vector. A Luciferase expression was significantly reduced following transfection with CD147-TT-pSICHECK2 (P < 0.01); the translational suppression of miR-3976 can be reversed by its inhibitor. B There was no significant statistical difference between the groups following transfection with CD147-CC-pSICHECK2. C Luciferase activity was decreased by miR-3976 in dose-dependent manner for the constructs with a TT genotype but not changed for constructs with a CC genotype at the rs6757:T>C polymorphism. Each transfection was carried out in triplicate. * denotes a p value < 0.05; ** denotes a p value < 0.01

Full size image

Discussion

In accordance with the principle of genetic diversity, differences in evolution and environment result in differences in genes and phenotypes between different populations [20, 21]. Therefore, it is important to study the relationship between these genetic variants and genetic susceptibility of different people. To our knowledge, no study has been conducted on rs6757:T>C and HCC risk in the South Chinese population.

In this research, we calculated the associations between the rs6757 and risk of HCC in 155 HCC patients and 151 controls. We find an obvious relationship between C/T variant (rs6757) and the genetic susceptibility of HCC, participants carrying allele C had a distinctly increased risk of HCC (OR = 1.826, 95% CI [1.263–2.642]; P = 0.001).

As shown in Fig. 1, the T/C variant (rs6757) is located in the seed region, nucleotides 2−7, of miRNA-3976, which means that the C/T variant (rs6757) has the potential to disrupt the binding of miR-3976 to CD147 3′-UTR. We predicted and calculated the minimal free energies of the secondary structures of miR-3976 bounding to the CD147 3′-UTR containing T/C variant (rs6757) by computational modeling. The minimal folding energy and the ΔΔG value were used to assess the impact of SNPs on the binding ability of the miRNA with its target mRNA [22]. The minimal folding energies of the duplexes rs6757-T-containing (− 24.7 kcal/mol) is lower than that of the duplexes rs6757-C-containing (− 20.2 kcal/mol). The lower minimal folding energies, the more stable binding of miR-3976 to the CD147 mRNA. The sum of the ΔΔG value was 4.5 kcal/mol, the higher sum of the ΔΔG value of the rs6757, the more likely to be a functional SNP.

As expected, luciferase reporter gene assay showed that miRNA-3976 suppressed the luciferase construct bearing the TT, but not the CC, genotype of the rs6757 (Fig. 7). Our investigation confirm that the C/T variant (rs6757) has an obvious effect on miR-3976 binding affinity, which causes greater suppression when miR-3976 bounding to CD147 3′-UTR containing the T allele rather than the C allele.

Despite many new discoveries mentioned above, there are some limitations in this study. First, although we selected health individuals without signs or symptoms of HCC as the control group, it should be noticed that the controls did not undergo a CT or MRI plain scan. Second, the sample size in the present study was still not large enough to reveal genes with allele frequencies between 5 and 10% [23]. Third, taking into account geographic variations, the prevalence of C/T variant (rs6757) in the South Chinese population may bias the results based on the single-center case-control studies. Fourth, which confounding factors should be selected for multivariate analysis has always been a controversial problem. Generally, most researchers choose the following two methods to solve this problem. One is that only dissimilar confounding factors should be corrected. The other suggests all confounding factors should be corrected. In this paper, we adopted the second approach. Actually, no matter which method you choose, the statistical results have no significant change. Finally, We simply verified that the rs6757:T>C would affect on the binding of miR-3976 to CD147 3′-UTR using the luciferase reporter assay in HEK293T cells. Next, we will study the relationship between the rs6757 and HCC in vitro at least two liver cell lines.

To sum up, we have revealed that CD147 is a direct target of miR-3976, and the C/T variant (rs6757) could affect on the binding of miR-3976 to CD147 3′-UTR, which result in a statistically significant association between the rs6757 and risk of HCC in the South Chinese population. However, further studies are needed to explore the new mechanism of subtle gene regulation of CD147 through miR-3976 binding capacity affected by rs6757.