Background

Osteoporosis is a major public health problem with growing prevalence. Obesity and hyperlipidemia have been demonstrated to be closely related with osteoporosis [1–3]. And osteoporosis is especially prevalent in the elderly population, and it is a significant public health issue that reduces patient functioning and quality of life. Moreover, both osteoporosis and obesity have high genetic predisposition and the genetic correlation between them have been established across different ethnic groups [1, 4]. Serum amyloid A (SAA) is a kind of apolipoprotein and is primarily synthesized in the liver by activated monocytes and macrophages [5]. As an apolipoprotein, SAA is associated with HDL-C and during inflammation can contribute up to 80% of its apoprotein composition [6]. Many studies have demonstrated that sustained high expression of SAA may contribute to atherogenesis [7, 8], and that an elevated concentration of SAA is associated with an increased risk of CVD [9]. And serveral studies indicated rs12218 in the SAA1 gene was associted with carotid atherosclerosis [10] and peripheral arterial disease [11]. However, the relationships between SAA gene polymorphisms and osteoporosis remain unclear.

In the present study, we aim to study the relationship between SAA1 gene polymorphsim (rs12218) and HDL-C level and osteoporosis.

Results and discussion

Table 1 shows the clinical characteristics of the study participants, the following values were significantly different between the 2 groups: systolic blood and age. There was no significant difference in the following variables between the 2 groups: DBP, body mass index (BMI), plasma concentration of total cholesterol (TC), plasma concentration of TG, HDL-C and LDL-C.

Table 1 Characteristics of these two groups
Full size table

Table 2 shows the distribution of the genotypes and alleles of the rs12218. The genotype distribution of each rs12218 did not show significant difference from the Hardy-Weinberg equilibrium values (data not shown). For total participants, the genotype and the allele distribution of rs12218 differed significantly between the osteoporosis patients and the control participants (both P<0.001). The TT genotype and T allele were more common in the osteoporosis patients than in the control participants. Logistic regression was performed with and without lipid disorders and other confounders. The TT genotype of rs12218 still differed significantly between these two groups (P<0.001, OR=7.610, 95% CI: 3.484-16.620, Table 3).

Table 2 Distributoion of genotypes and allels
Full size table
Table 3 Logistic regression analysis
Full size table

Table 4 shows the relationgship between rs12218 and TG, TC, HDL-C LDL-C, and BMD levels. In the osteoporosis group, we found that the rs12218 was not only significantly associated with plasma TC, HDL-C, and LDL-C levels (P=0.021, P=0.009, and P=0.009, respectively), but also associated with BMD (P<0.05). However, this association was not found in the control group. And, we did not find the TG level was significantly associated with rs12218 in these two groups. In addition, we also found the rs12218 was associated with the plasma SAA levels not only in the case group, but also in the control group (Figure 1).

Table 4 The relationship between genotypes and TG, TC, HDL, LDL and BMD
Full size table
Figure 1
figure 1

The SAA concentrations between genotypes of rs12218.

Full size image

In the present study, we found that variation in the SAA1 genes is associated with both osteoporosis and TC, HDL, and LDL levels in osteoporosis in Chinese population. This is the first study to observe the relationship btween SAA1 gene and osteoporosis. Osteoporosis is characterized by low bone mass, an increase in bone fragility, deterioration in bone microarchitecture, and an increase in the risk of fracture [12]. Some metabolic changes, such as those that occur due to a lack of estrogen, immobilization, metabolic acidosis, hyperparathyroidism, and systemic and local inflammatory diseases, affect the osteoclast count and activity associated with bone turnover [13]. Prostaglandins, insulin-like growth factors (IGFs), interleukins (IL-1, IL-6, and IL-11), tumor necrosis factor (TNF), and several local factors in bone, such as transforming growth factor (TGF), also contribute to the regulation of bone formation and resorption [13, 14].

The gene for SAA1 was considered as a candidate for osteoporosis because it is the gene encoding one important inflammation factor, SAA, which is synthesized by the liver. A relationship between the SAA1 gene polymorphism and cardiovascular diseases has been reported previously [10, 11] as follows: Sense: 5′AACAGGGAGAATGGGAGGGTGGG3′; Antisense: 5′ GCAGGTCGGAAGTGATTGGGGTC3′. The PCR mixture was subjected to 35 cycles for 60 sec at 94°C, 30 sec at 54°C, and 40 sec at 72°C following the initial denaturation for 3 min at 94°C. These PCR products were digested by Bgl I restriction enzyme was according to manufacturer’s instructions. To ensure the results to be verified, we used sequenced genomic DNAs as positive controls in our assays.

Statistical analysis

The data were evaluated using SPSS Version 17 software (IBM Corp. Armonk, New York, USA). The continuous variables were not normally distributed based on the Shapiro-Wilk test for normality. The Mann–Whitney U test was implemented for the comparison of the two groups. Medians (quartiles) are provided as descriptive statistics. The Pearson chi-square test was conducted for categorical variables. N and % values are provided. A p<0.05 was considered statistically significant.