Correction: Mol Cancer 19, 20 (2020)
https://doi.org/10.1186/s12943-020-1134-8
Following publication of the original article [1], the authors would like to request for the below changes.
1. We request to replace the misused image in Fig.2H-Scramble-96h with the correct image.
Figure 2H
![figure a](http://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs12943-024-02018-7/MediaObjects/12943_2024_2018_Figa_HTML.png)
2. We request to replace the misused images of Fig. 3I-circ001680+miR340 and 3L-ki67- circ001680+miR340 with the correct images.
Figure 3I and 3L
![figure b](http://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs12943-024-02018-7/MediaObjects/12943_2024_2018_Figb_HTML.png)
3. We request to replace the misused images in Figure S2A-Vector, Figure S2B and 2C with the correct images.
![figure c](http://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs12943-024-02018-7/MediaObjects/12943_2024_2018_Figc_HTML.png)
4.We request to replace the misused images in the Figure S4A-a-tublin and S4E-0ug+DMSO with the correct images.
Supplementary Figure S4A and 4E
![figure d](http://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs12943-024-02018-7/MediaObjects/12943_2024_2018_Figd_HTML.png)
5. We request to replace the sequences in Supplementary Table 1 of miR-340 and circ_001680.
miR-340 | F:ACACTCCAGCTGGGTTATAAAGCAATGAGACT | R:CTCAACTGGTGTCGTGGAGTCGGCAAGAGTCGGCAATTCAGTTGAGAATCAGTCTCAT |
Bio-circ_001680-probe | 5’Bio-TATAACCCTGCTCAGATACATCAAAC-3′-Bio | |
Bio-miR-340-probe | 5’BIO-AATCAGTCTCATTGCTTTATAA- 3’BIO | |
Digo-circ_001680-probe | 5’Digo-TATAACCCTGCTCAGATACATCAAAC-3′-Digo |
The correction does not change the results and scientific conclusions of this article. We sincerely apologize to the editor, reviewers and readers for the errors and any confusion it may have caused.
Reference
Jian X, He H, Zhu J, et al. Hsa_circ_001680 affects the proliferation and migration of CRC and mediates its chemoresistance by regulating BMI1 through miR-340. Mol Cancer. 2020;19:20. https://doi.org/10.1186/s12943-020-1134-8.
Author information
Corresponding author
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Jian, X., He, H., Zhu, J. et al. Correction: Hsa_circ_001680 affects the proliferation and migration of CRC and mediates its chemoresistance by regulating BMI1 through miR-340. Mol Cancer 23, 100 (2024). https://doi.org/10.1186/s12943-024-02018-7
Published:
DOI: https://doi.org/10.1186/s12943-024-02018-7