Abstract
Plasmodium vivax gene regulation remains difficult to study due to the lack of a robust in vitro culture method, low parasite densities in peripheral circulation and asynchronous parasite development. We adapted an RNA-seq protocol “DAFT-seq” to sequence the transcriptome of four P. vivax field isolates that were cultured for a short period ex vivo before using a density gradient for schizont enrichment. Transcription was detected from 78% of the PvP01 reference genome, despite being schizont-enriched samples. This extensive data was used to define thousands of 5′ and 3′ untranslated regions, some of which overlapped with neighbouring transcripts, and to improve the gene models of 352 genes, including identifying 20 novel gene transcripts. This dataset has also significantly increased the known amount of heterogeneity between P. vivax schizont transcriptomes from individual patients. The majority of genes found to be differentially expressed between the isolates lack Plasmodium falciparum homologs and are predicted to be involved in host-parasite interactions, with an enrichment in reticulocyte binding proteins, merozoite surface proteins and exported proteins with unknown function. An improved understanding of the diversity within P. vivax transcriptomes will be essential for the prioritisation of novel vaccine targets.
Similar content being viewed by others
Introduction
Plasmodium vivax is the second most prevalent malarial infection worldwide, and infection rates are continuing to increase as many global elimination strategies remain focused on P. falciparum malaria1,2. P. vivax is the dominant malaria species in Southeast Asia, South America, and Northeast Africa. Advances in the biological understanding of P. vivax are inhibited by the lack of a continuous culturing method and a corresponding shortage of functional assays in comparison to those available for P. falciparum, which has been broadly studied after culture adaptation was first achieved in 19763. Since the absence of continuous in vitro culturing methods restrict experimental progress, most techniques to study P. vivax rely on parasites sampled directly from patient donors, but these are limited in quantity and can be challenging to access. Studies relying on P. vivax clinical parasite samples have additional challenges to overcome because of the mixture of parasite blood stages that are asynchronous in peripheral circulation (due to the lack of sequestration in this species), as well as frequent polyclonal infections and difficulties obtaining sufficient parasite genetic material for downstream analysis4,5,6,7.
The first reference genome available for P. vivax was the Salvador-I (Sal1) reference genome, which is highly fragmented (> 2500 unassembled scaffolds). P. vivax genomes have substantial geographically-distinct genetic diversity and a significant proportion of the disease burden lies in Southeast Asia, whereas the Sal-I strain was originally isolated in El Salvador8. Recently, a new reference genome from a Papua Indonesian isolate was released that combined short- and long-read sequencing technology, and consequently made considerable improvements in assembly and annotation (PvP01) compared to Sal1. This has greatly improved the understanding of P. vivax genome structure and read map** for patient isolates9.
The first transcriptomic studies of P. vivax from field isolates and its comparison with other Plasmodium species were performed with microarrays, and showed similar cascades of stage-specific gene expression found in other Plasmodium species, where most genes show a clear peak of transcript at a specific time point in the intraerthyrocytic developmental cycle (IDC), with regulation presumed to involve ApiAP2 DNA-binding proteins10,11,12,13. The first study to use RNA-seq in P. vivax was able to describe the features of the transcriptome more comprehensively, as previously unannotated untranslated regions (UTRs) and splice sites were outside the technical capabilities of microarrays14. Other previous studies of bulk RNA-seq from patient isolates have been performed on both a time course and with asynchronous samples15,16,17, and with primates in laboratory conditions18.
Here we describe RNA-seq data from purified schizonts collected from four Cambodian patient isolates that had been subject to short-term ex vivo culture to allow for parasite maturation. The data was generated with minimal PCR amplification, based on the DAFT-seq protocol (directional, amplification-free transcriptome sequencing); this data was able to help further refine and increase the resolution of the annotation of the PvP01 reference genome, including identification of novel transcripts and correction of several hundred gene models. The increased evenness in coverage in this dataset provides an improved view of the ex vivo schizont transcriptome, as a large number of PCR amplification cycles in a standard RNA-seq library preparation induces bias by preferentially enriching for GC-rich regions of the genome, and reducing coverage in the most AT-rich regions where UTRs and ncRNAs are present. We also describe new features of the transcriptome, such as transcription start site associated RNAs (TSSa-RNAs) and intron-like features overlap** protein-coding exons (exitrons). We also generated a comprehensive list of enriched P. vivax schizont genes which provides the potential of a more in-depth understanding of P. vivax merozoite invasion, which to date is largely limited to a comparison with P. falciparum invasion homologs and a handful of known P. vivax invasion gene families such as the duffy binding like proteins (DBLs), reticulocyte binding proteins (RBPs), and merozoite surface proteins (MSPs)19,20,21,22.
Results
Preparation of purified late-stage schizont transcriptomes
Four blood samples from Cambodian patients were selected to undergo short-term ex-vivo culture. After the majority of parasites had matured, as judged by microscopy, late-stage schizonts were purified using Percoll gradients, which are denser than other parasites in the blood stages. Four RNA-seq libraries were generated using a modified version of the DAFT-seq protocol, which was optimised for highly AT-rich Plasmodium parasites23, and sequenced using the Illumina platform to generate 55–63 million reads per patient sample. In all cases > 85% of reads mapped to the P. vivax PvP01 reference genome (Table S1). This data was used to improve the gene models of 352 genes in the PvP01 genome, including identifying 20 novel gene transcripts (Table S2). Comparison of the expression values of these RNA-seq libraries to blood stage microarray time course from a P. vivax dataset (containing three patient isolates)12 (Fig. S1) and a more densely sampled P. falciparum dataset24 (Fig. S2). The samples correlated most closely with late-stage schizont time points in the prior datasets, suggesting that the Percoll enrichment had been largely successful. We cannot however rule out that other stages were present at some low level, but this does not affect subsequent analysis, which is focussed on characteristics of the overall transcriptome rather than stage-specific analysis. The transcriptomes were also highly similar to each other, as the correlation of the normalised expression values of the RNA-seq libraries was close to 1 (Fig. S3). More apparent heterogeneity was found between the patient isolates using the PvP01 genome than using only the gene IDs present in the Sal1 genome (Fig. S4), consistent with most of the heterogeneity within the patient isolate transcriptomes being present in multigene families that are difficult to assemble and annotate, and are thus under-represented in the Sal1 genome.
The architecture of the Plasmodium vivax schizont transcriptome is dense and overlap**
We used the RNA-seq data from the four patient isolates to define the extent of the P. vivax late-stage schizont transcriptome. We were able to detect transcription from 78% of the genome sequence using a threshold of 5 reads (as used in Siegel et al.25). We were able to detect expression of 5017 protein-coding genes (75% of annotated genes) at a threshold of 5 reads per kilobase per million mapped reads (RPKM), with the majority (3974 genes, 60% of annotated genes) of these genes also detected as expressed at a much more conservative threshold of 20 RPKM (Table S3).
We defined the 5′ untranslated regions (UTRs) for 4155 genes in the PvP01 genome using the RNA-seq data (Fig. 1a, Table S4) (83% of those detected at > 5 RPKM). We also defined 3′ UTRs for 4091 genes (Fig. 1b, Table S5) (82% of those detected at > 5 RPKM). We used an approach developed for P. falciparum RNA-seq data23 to define UTRs in AT-rich regions. This computational approach (Fig. S5) relies on RNA-seq data map** continuously across the length of an mRNA, which is a key strength of the RNA-seq protocol used in this study. The precise boundary of the UTR for each molecule is likely to vary slightly, so to annotate a single fixed position for each mRNA boundary, we estimated a true position by defining the location where the continuous RNA-seq coverage falls below a threshold of 5 reads. To avoid merging adjacent UTRs on the same strand we used a more stringent threshold; the threshold for defining a block of continuous transcription was iteratively increased, in steps of 5 reads. The mean length of 5′ UTRs was 1007 nt (median length 815 nt), and was 818 nt for 3′ UTRs (median was 685 nt), which is longer than those described in previous studies in P. vivax14,15. These are also longer than the 5′ and 3′ UTR lengths recently described in P. falciparum23 (577 nt and 453 nt, respectively). This difference is likely primarily technical in nature, due to many fewer sequences of > 90% AT content disrupting continuous coverage in the P. vivax transcriptome relative to the P. falciparum transcriptome. The longest 5′ UTR detected was 6846 nt, which belonged to the gene AP2-G (PVP01_1440800) (Fig. S6), which also had the longest 3′ UTR (5908 nt). Together these extended UTRs allow us to define that the majority of the genome (at least 73%) encodes mRNAs; this is an underestimate of the true value, as not all genes are expressed in these samples which are highly enriched for schizonts.
The extent of the P. vivax schizont transcriptome. (a) Size distribution of 5′ UTRs (n = 4155). (b) Size distribution of 3′ UTRs (n = 4091). (c) An overview of the extent of transcription from a representative portion of the P. vivax genome sequence (from chromosome 12). The coloured lines in the upper panel represent directional RNA-seq coverage from each of the four patient isolates, while the lower panel includes gene models on both strands of the genome sequence. (d) Overlap** transcripts are found even within a single life stage in P. vivax. The example shown is of a gene pair in a “tail-to-tail” orientation (PVP01_1416800 and PVP01_1416900). The boundaries of the mRNA sequence of the second gene in this pair is contained within the 3′ UTR sequence of the first gene in the pair.
A region of the genome containing multiple genes detected in schizonts is shown in Fig. 1c. A significant number of genes substantially overlap each other, and we detected hundreds of overlap** transcripts even within this specific life stage. There were 1822 genes where the 3′ UTRs overlapped. An example of a gene pair in a “tail-to-tail” orientation (where the genes are on opposite strands, PVP01_1416800 and PVP01_1416900) is shown in Fig. 1d. The boundaries of the mRNA sequence of the second gene in this pair is contained within the 3′ UTR sequence of the first gene in the pair. We found many examples of genes in a “head-to-head” orientation that appear to share a bidirectional promoter. In some cases these 5′ UTRs are directly adjacent (Fig. S7a), while others (968 genes) show some overlap (Fig. S7b).
Identification of new splice sites and non-coding transcription
We also used the RNA-seq data to search for additional non-coding transcripts, using blocks of continuous coverage like those used for detecting UTRs. We found evidence of non-coding transcripts showing spatial patterns of expression similar to the patterns of transcription start site associated RNAs (TSS-associated RNAs) recently described in P. falciparum 23, which are found in an antisense orientation to the 5′ end of mRNAs, such as the example shown upstream of the gene AP2-G3 (PVP01_1418100) (Fig. S8).
We were also able to use the RNA-seq data to detect splice sites. We used an approach previously applied to P. falciparum DAFT-seq data23, where all spliced reads are examined and categorised. We found 8217 splice sites that were already annotated for the PvP01 genome available in online databases, to which we added 7418 new splice sites (Fig. 2a, Table S6). We found 3015 splice sites in UTRs, including 282 that affect the position of start or stop codons, as well as 2164 splice sites enabling isoform variation within protein-coding exons. We also found evidence for alternative splicing in 2.3% of coding genes. This proportion is lower than estimates in P. falciparum DAFT-seq data23, but this data set covers only a portion of the IDC.
Splice sites present in P. vivax schizonts. (a) Thousands of splice sites were detected in the RNA-seq data (left), with splice sites not found in online databases (right) falling into a range of categories for both coding and non-coding regions of RNAs. (b) An exitron was identified in RNA-seq data for the gene PVP01_1461000. This exitron is 132 nt, a multiple of 3 nt, which can be spliced out without changing the reading frame of this protein. The vast majority of the transcripts for this mRNA contain the spliced form of the exitron.
In addition to conventional splice sites, we also found evidence for the presence of exitrons in P. vivax transcripts, which are intron-like features within exons where splicing can change protein sequence and hence increase proteome diversity26. Crucially, exitron splicing does not necessarily maintain the open reading frame of the protein, causing a diversification of protein sequences. An equally important role may be enabling another layer of regulation of transcript levels through mechanisms such as nonsense-mediated decay of transcripts that would produce non-functional proteins. Putative exitrons have recently been identified in P. falciparum23. Using our pipeline, there were 702 splicing events within exons that show some exitron properties (Table S7). For example, for PVP01_1461000, 132 nt (a multiple of 3 that retains the open-reading frame) is spliced out in the vast majority of the detected transcripts (Fig. 2b). Detailed mechanistic studies would be needed to establish the functions of these exitrons in Plasmodium species.
Identification of patterns of similarity and heterogeneity between patient isolates
As part of the sample generation process, Percoll-purification was used to isolate schizonts, which has the advantage of eliminating the mixture of asexual blood stages typically seen in clinical infections. As a result we could use this data to characterise heterogeneity between P. vivax schizont transcriptomes. We first looked at the genes with the highest abundance in each patient isolate and found that there was a large overlap in the highest schizont-expressed genes in each sample, with 20 of the top 25 most highly expressed genes being present among the top 25 most highly expressed genes for all four patient isolates (Table 1). Several of the highest expressed genes belong to families implicated in host-parasite interactions, such as the merozoite surface proteins (MSPs), and early transcribed membrane proteins (ETRAMPs), with the majority of highest expressed genes being those that encode proteins involved in translation. Both histones and ribosomal RNA subunits were highly expressed, and expected to be seen in mature parasite stages undergoing active replication. Patterns of RNA-seq coverage across the genome are also highly conserved among patient isolates, with chromosome 12 as a representative example showing the vast majority of genes being transcribed at very similar levels (Fig. 1c).
We used two metrics of expression variability, coefficient of variation (\({Cv)}\) and the index of dispersion (D), to identify genes that are variable between patient isolates. The intersection of the top 300 ranked genes derived using each metric were used to create a list of 87 genes that were differentially expressed between the isolates (Table S8). Because many of the most variably expressed genes belong to multigene families known to have considerable sequence variation compared to the reference genome, we next evaluated the extent to which read map** difficulties due to sequence variation were impacting read counts (and therefore downstream expression RPKM calculations). RPKM calculations leverage the number of reads that map to a gene across the entire length of coding sequence for each gene, while normalising for sequencing depth and gene length, giving reads per kilobase million mapped reads. In order to minimise the impact of read map** drop out that would occur in some regions of a gene that have high sequence variation, we calculated RPKM values from reads only in regions of coding sequence where all isolates had at least five mapped reads, and stitched these regions together to re-calculate RPKM values for each gene (Table S9, Fig. S9). This method, which allowed regions of considerable sequence divergence between the isolates to be ignored and hence true expression variation between each of the isolates to be assessed without the impact of sequence variation, resulted in a list of 105 differentially expressed genes (Table S10). All of the 87 differentially expressed genes found in the analysis of the full coding regions were found in this second round of analysis of only conserved transcribed regions. Of the final list of 105 differentially expressed genes, 23 were not present in the Sal1 genome assembly, highlighting the importance of using the most complete annotation available.
A large proportion of the 105 genes shown to be differentially expressed between the four isolates occurred in several gene cluster hotspots, the largest of which are on chromosomes 5 and 10 (Table 2). Many differentially expressed genes belong to several multigene families implicated in immune evasion, antigenic variation and virulence, such as the msp, phist, vir and trag families (Table 2). Several other gene families involved in host cell recognition were also found to have differential expression profiles, specifically the reticulocyte binding proteins (RBPs) and tryptophan-rich proteins (TRAG) and duffy binding protein (DBP) (Table 2). There was no correlation between genes that had the highest levels of expression and those with highest variability between isolates, which was expected because as noted above, the top expressing genes were highly correlated between isolates. We suggest that these genes may be subject to epigenetic variation, as specific family members are differentially expressed across the four isolates. There is direct experimental evidence for epigenetic regulation multigene families in other Plasmodium species, such as the pir gene family27 (which includes the P. vivax vir genes) and experiments with clonal parasites have shown that epigenetic regulation occurs in numerous gene families in P. falciparum28.
The sequence-variation adjusted RPKM analysis confirmed that the vast majority of highly-expressed genes in each isolate were conserved compared to the initial analysis of differential expression results, with only one of two genes changing in the top 25 highest expressed genes for each isolate, which would be expected to stay largely the same with the use of these strict parameters for map** (Table S9). For the genes with highest variability between isolates, nearly all the genes from the original analysis remained significantly variably expressed (81/86), with the exception of five genes including two msps (msp3.9 and MSP3.2). MSP3.9 and MSP3.2 appear to be an example of sequence variation causing variable levels of map** instead of true expression variation, as seen in Fig. 3a where map** of the msp3 locus shows individual isolates with reads map** for some isolates but not others. For msp3.9, isolate 4 shows a distinct peak of expression in the middle of the transcript, where the other isolates drop off in expression likely due to sequence variation, and adjusted analysis corrects for these differences, finding that there is no longer a significant variation in expression for the four isolates after correction (Fig. 3a). Similarly, the msp3.2 locus has a similar profile with high levels of expression for isolate 2 that is lost upon RPKM correction (Fig. 3a). Adjusted RPKM analysis additionally found 23 new genes to be highly variably expressed, including six pir genes and several putative exported proteins, many of them belonging to the phist superfamily which were the most represented of all the gene families, as well as reticulocyte binding protein 2c (PVP01_0534300) (Table S10).
Variation in RNA-seq data between the four patient isolates. (a) RNA-seq coverage data (lines in top panel) for the region on PvP01 chromosome 10, which contains the sequences of multiple MSP3 genes (shown in red on the lower panel). Levels of transcripts detected for each of the genes in this locus vary between each of the patient isolate (see key in figure to identify traces). Drops in coverage within an annotated gene model are likely to represent sequence divergence in the patient isolates from the reference genome. (b) RNA-seq coverage data (lines in top panel) for a region of PvP01 chromosome 10. The four patient isolates show very similar transcript levels for most of the protein coding genes in this region. However, an unannotated ncRNA (highlighted by a box) was only found in isolate 4, opposite to the gene PVP01_1236300.
Discussion
The data presented in this study enabled us to examine the extent of the P. vivax schizont transcriptome in samples derived from multiple patient isolates. We were able to identify transcripts originating from 75% of annotated protein coding genes, and to infer transcription from 78% of the genome sequence.
Our analysis has increased the amount of P. vivax genome sequence that can be annotated as encoding 5′ and 3′ UTRs. The median length of the 5′ UTRs (n = 4155) is our data set was 815 nt, and was 685 nt for 3′ UTRs (n = 4091). In the first P. vivax RNA-seq study14, the median length of 5′ UTRs was 295 nt (n = 3633), and the median length of the 3′ UTRs was 203 nt (n = 3967). In a more recent P. vivax RNA-seq study15, the median lengths of the was 754 nt for 5′ UTRs and 785 nt for the 3′ UTRs (n = 3230); the lack of a difference in relative lengths of the 5′ and 3′ UTRs is likely to be a feature of the computational approach used in that work, which did not consider each UTR independently. The improved annotation of UTRs in this data was enabled by a more even coverage of AT-rich regions of the genome compared to other studies, in tandem with a computational approach developed specifically for Plasmodium genomes. This custom approach makes use of blocks of continuous RNA-seq coverage to identify UTRs, so is less likely to merge fragments of RNA-seq coverage from independent gene models than approaches that are built for genomes where gene models are further apart (such as mammalian genomes) Future studies comparing similarities in UTRs between and within Plasmodium species may be able to identify RNA-binding motifs relevant to gene regulation, though it should be noted that the AT-rich nature of these sequences restricts application of existing motifs for predicting RNA structure. The extended UTR sequences enabled identification of hundreds of overlap** transcripts pairs, even though all of the UTRs were called within the same life cycle stage. This observation suggests levels of complexity in gene regulation in P. vivax that are not yet fully understood, as only one DNA strand can be transcribed at any given time. Future single cell RNA-seq studies may be able to clarify this, but will require understanding of UTR boundaries to interpret sparse and noisy data.
Detection of previously undescribed features of the P. vivax transcriptome will enable a more nuanced understanding of gene regulation in this species. The detection of the presence of TSS-associated RNAs in P. vivax reveals a new class of RNAs in P. vivax, however it remains to be proved whether these transcripts play a direct regulatory role (such as binding proteins near active TSS), or are a byproduct of transcription of mRNAs that has no further function. The extended catalogue of splice sites in P. vivax will help to better understand gene regulation within the species. We note that other studies have identified splice sites14,15, but this study is the first to identify the presence of exitrons in P. vivax. Exitrons were first described in humans and plants26, and can be used to increase proteome plasticity as well as to regulate transcript levels through alternative splicing, including transcript degradation by nonsense-mediated decay. Exitrons were recently described in P. falciparum23, and may prove to be an important component of gene regulation across the Plasmodium genus.
The use of a Percoll gradient to generate matched-stage schizont samples from multiple patient isolates has enabled an analysis of genes that are differentially expressed between the parasites isolated from each patient. Most genes have highly similar patterns of expression between the patient isolates, enabling differences in staging to be removed from the analysis. This enables focus on the genes that are truly variable between patient isolates. Of particular interest was how schizont transcription from patient infections are different to one another, as the transcriptional heterogeneity could have profound impacts on the host immune response and perhaps even the invasion phenotypes of the parasites. Prior studies have implicated that high levels of invasion related proteins like Duffy binding protein (DBP1) could enable parasites to invade duffy negative erythrocytes, and P. vivax may additionally have alternative invasion pathways independent of DBP129,30,31. Recent studies of SalI parasites infecting Aotus and Saimiri monkeys looked at potentially unique invasion pathways and implicated the differential expression of the tryptophan-rich protein family in mediating this process18. No clear pattern of differential expression was shown in the four patient isolates studied, however the expression heterogeneity of these erythrocyte-binding proteins in this study and several others warrants further investigation about the involvement of these in host recognition.
Many of the genes most variably expressed between the isolates appear to cluster in physical space along regions of the chromosomes (Table 2), such as multiple members of the MSP3 family, which are known to be under heavy diversifying selection32,33, as shown in Fig. 3. Levels of higher and lower transcription within each cluster of variably expressed genes suggest that the parasites are making choices about which version of the gene to express within a patient. Epigenetic regulation of multigene families has been studied in P. falciparum, with mechanisms capable of selecting specific members of gene families thought to be observed across the genus34. It is likely that P. vivax parasites are capable of selecting particular members of gene families to be expressed in response to the host, which is supported by recent evidence describing the response of P. vivax parasites to different primate hosts18. Our evidence of putative spatial relationship between genes which are variably expressed suggests that chromatin structure and accessibility may be important in this class of gene regulation, as transcriptional heterogeneity has been implicated to be of considerable importance in parasite survival to changing host conditions28,35. In the case of the msp3 locus, the paralogs are likely examples of functional redundancy that acts to ramp up antigenic diversity, enhancing the ability to evade the immune system during invasion32. For other multigene families, such as the vir genes, are subtelomeric genes involved in the establishment of chronic infections, and have been shown to be regulated independently of the cell cycle. Clonally-variant expression seen in vir genes has been established previously, and indeed we found that all the vir genes differentially expressed in the current study had evidence varying amounts of expression, and unsurprisingly, had no obvious on/off transcriptional pattern36. Overall, this bet-hedging strategy is an effective one where stochastic changes in expression levels between individual parasites spreads out the immunogenic risk among the population, allowing selection on existing variation and survival of the fittest among them. Future studies of P. vivax transcriptomes should consider this layer of heterogeneity.
Methods
Field isolate collection and schizont enrichment
Samples were selected for ex vivo culture from P. vivax malaria patients presenting to Sampov Meas Referral Hospital, Cambodia. These patients had not taken antimalarials within 1 month of sample collection and had parasitemia of < 0.1%. Written informed consent was obtained from each donor. Prior approval of the clinical study protocols were obtained from the National Ethics Committee for Human Research (Clinical Trials.gov Identifier: NTC00663546) in Cambodia, and by the Institutional Review Board, NIAID, NIH. The clinical trial was conducted and data were generated and biological specimens were collected, and reported in compliance with the study protocol (approved by the Institutional Review Board, NIAID, NIH and the National Ethics Committee for Human Research in Cambodia), International Conference on Harmonisation Good Clinical Practice (ICH GCP), and Good Laboratory Practices (ICH GLP). Sample processing in the field was undertaken as previously described (Russell et al., 2011). Briefly, four P. vivax isolates were processed (PV0417-3, PV0563, PV0565, PV0568). Patient blood samples (16 ml for ages < 18 years and 32 ml for ≥ 18 years) were collected by venipuncture into sodium heparin vacutainers, then were centrifuged (2000 rpm for 5 min) and plasma was removed. Samples were diluted with PBS (up to 64 ml, mixed by inverting tube), depleted of white blood cells and platelets (pass over autoclaved, pre-wet CF11 columns packed to the 5.5-ml mark in a 10-ml syringe, and collect flow through), washed twice (centrifuged at 2000 rpm for 5 min, washed with 1 × PBS, repeated 1 time), and placed into ex vivo culture conditions (resuspended with packed cells at a 10% hematocrit in modified McCoys 5A complete media with 25% AB serum, and cultured at 37 °C, 5% CO2) until the parasites matured to schizonts as identified by Giemsa stained microscopy. After maturation, cultures were pelleted (centrifuge at 2000 rpm for 5 min), the supernatant was removed, and cells were resuspended (to 50% hematocrit in 1 × PBS). To prevent rosetting, cells were treated with trypsin (7.5 ml of 500 mg/l Trypsin-Versene) and incubated at 37 °C for 15 min. To stop digestion, samples were diluted (add 2 × volume of 1 × PBS) and centrifuged (2000 rpm for 5 min). The recovered pellet was then incubated with AB serum (6 ml for 5 min at RT), diluted with PBS (up to 30 ml) and separated on a 45% isotonic Percoll gradient (5 ml of suspension overlaid on six 15-ml tubes containing 5 ml 45% isotonic Percoll each). The suspensions were centrifuged (1200 RPM for 15 min) and the fine band of concentrated schizonts on the Percoll interface was removed, centrifuged (2000 rpm for 5 min), and resuspended (5 ml of 1 × PBS and counted via hemocytometer). The remaining sample was pelleted, mixed with up to 10 volume of RNAlater (1 ml) and divided into 2 cryovials (500 μl each).
RNA extraction and assessment of RNA purity by qPCR
RNA was isolated using the RiboPure Blood kit (Ambion) according to manufacturer instructions and subjected to 2 rounds of DNA digestion using the DNA-free kit (Ambion) according to manufacturer instructions. Samples were analysed with a Bioanalyzer 2100 (Agilent Technologies, Inc.) using an RNA Nano Chip to test quantity and quality. To test for genomic DNA contamination, 1 μl of RNA solution was used to make cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to manufacturer instructions. Using both RNA and cDNA samples, a region surrounding an intron in the PvDBP gene PVX_110810 (5′: AAACCGCTCTTTATTTGTTCTCC, 3′: TTCCTCACTTCTTCTTTCATT) was amplified by PCR. Reaction volumes were as follows: 2.5 μl buffer, 2 μl dNTP mix (10 μM), 0.1 μl Platinum Pfx DNA Polymerase (Invitrogen), 16.9 μl water, 1 μl of each primer (10 μM), 1 μl cDNA or extracted RNA. Thermocycler conditions were as follows: incubation at 95 °C for 15 min, 35 cycles consisting of denaturation at 95 °C for 40 s, annealing at 55 °C for 40 s, elongation at 68 °C for 1 min, followed by a final extension at 65 °C for 5 min.
RNA-seq libraries
A modified RNA-seq protocol (“DAFT-seq”23) was used to capture schizont transcriptomes generated in this study. Briefly, polyA + RNA (mRNA) was selected using magnetic oligo-d(T) beads. The polyA + RNA (mostly mRNA) was fragmented using a Covaris AFA sonicator using the following settings: Duty cycle 10%, Intensity 5, Cycles per burst 200, Time 60 s, then was precipitated using ethanol. Reverse transcription using Superscript II (Life) was primed using random primers in a 20 uL reaction, the RNA–DNA hybrid was cleaned using 1.8 × reaction volume with Agencourt RNAClean XP, then second strand cDNA synthesis with DNA pol I and RNase H, and included dUTP. A “with-bead” protocol was used for dA-tailing, end repair and adapter ligation (NEB) using “PCR-free” barcoded sequencing adaptors (Bioo Scientific, similar to Kozarewa et al.37. After 2 rounds of SPRI cleanup the libraries were eluted in EB buffer and USER enzyme mix (NEB) was used to digest the second strand cDNA, generating directional libraries. The libraries were subjected to 4 cycles of PCR using the 2 × KAPA HIFI HS Master mix. Reaction conditions were as follows: 95 °C for 5 min followed by 4 cycles of 95 °C for 20 s, 60 °C for 15 s, 72 °C for 60, and a final extension of 72 °C for 5 min, then cleaned using 1.0 × reaction volume with Agencourt RNAClean XP. The libraries were quantified by qPCR and sequenced on an Illumina HiSeq2000 using 100 bp paired end reads.
Sequence map** and quality control
The PvP01 reference genome9 and the January 2019 GeneDB annotation release were used for all analysis. The choice of reference genome can affect map** quality, and in choosing PvP01 we balanced both completeness of the assembly and annotation (which is a particular concern when analysing UTRs and multigene families, as we did in our subsequent analysis) and geographical similarity to our Cambodian samples. PvP01 was built from both short- and long-read sequence data, and has the highest assembly size and smallest number of unassigned scaffolds of any P. vivax reference genome published to date9. Isolated from a Papua Indonesian clinical isolate, PvP01 is also closer geographically to our Cambodian isolates than the widely used reference, El Salvador-1 (Sal1), which is South American in origin. While a Cambodian P. vivax genome assembly is available38, it was based on short-read data assembled into > 1000 fragments, which while useful for the discovery of new genes, would have greatly limited subsequent analysis of UTRs and multigene families if used as a reference.
Sequencing data from these samples has been made publicly available in the European Nucleotide Archive (ENA) under Study ID PRJEB32240. TopHat239 was used to map reads with directional parameters and a maximum intron size of 5000 nt. RNA-seq data was visualised using the Artemis genome browser40,41.
Identification of transcriptome features
Custom Perl scripts were used to calculate RPKM values, which used the BEDTools suite42. A custom approach described previously23 was used to detect new RNA sequences, including UTRs and ncRNAs, which also used the BEDTools suite. Spiced reads were identified using the CIGAR string in the DAFT-seq BAM files. Comparison with existing annotation allowed the detection of known spice sites. Splice sites in UTRs and ncRNAs were found by identifying overlap** spliced reads. Exitrons were found by identifying spliced reads map** within protein-coding exons. Detection of each splice site required at least 5 reads. Code is available online at https://github.com/LiaChappell/DAFT-seq.
Comparisons to other data sets
For comparison to microarray data sets, one-to-one orthologues were selected for comparison between time courses using Sal112 and for with P. falciparum24. Pearson correlation was calculated for orthologous pairs of genes present in both data sets. The corrplot R package was used to visualise the data.
Comparative analysis of isolates
A threshold of 5 RPKM (reads per kilobase per million mapped reads, a normalised measure of gene expression) was used to define detection of expression. In order to compare relative levels of expression between the individual isolates to look for expression variability, two metrics were calculated for each gene, the coefficient of variation (\(Cv)_{ }\) which is a ratio of standard deviation (\(\sigma )\) of RPKMs from the four isolates to the mean (\(\mu\)) RPKM:
and the index of dispersion (D), which gives an indication of the spread of expression results, represented as:
The intersection of the top ranked genes from each method were used to create a list of 86 differentially expressed genes between the isolates. Gene ontology (GO) terms and 1:1 P. falciparum homologs (29/86) were identified for differentially expressed genes using PlasmoDB43, and genes identified as part of the P. falciparum invadome were also evaluated against our dataset44.
To be able to differentiate between variable levels of expression and variable levels of map** (due to sequence variation in the isolates), we performed an additional round of analysis considering only regions of coding sequence where reads were mapped in all of the isolates. We examined blocks of continuous coverage where at least 5 reads were mapped, breaking coding sequences into multiple blocks that could be effectively considered as exons in downstream analysis of differential expression (see Fig. S7).
Data availability
Sequencing data from these samples has been made publicly available in the European Nucleotide Archive (ENA) under Study ID PRJEB32240.
References
Popovici, J. & Ménard, D. Challenges in antimalarial drug treatment for vivax malaria control. Trends Mol. Med. 21, 776–788 (2015).
World Health Organization. World Malaria Report 2018 (2018).
Trager, W. & Jensen, J. B. Human malaria parasites in continuous culture. Science 193, 673–675 (1976).
Friedrich, L. R. et al. Complexity of infection and genetic diversity in cambodian Plasmodium vivax. PLoS Negl. Trop. Dis. 10, e0004526 (2016).
Chan, E. R. et al. Whole genome sequencing of field isolates provides robust characterization of genetic diversity in Plasmodium vivax. PLoS Negl. Trop. Dis. 6, e1811 (2012).
Fola, A. A. et al. Higher complexity of infection and genetic diversity of Plasmodium vivax than Plasmodium falciparum across all malaria transmission zones of Papua New Guinea. Am. J. Trop. Med. Hyg. 96, 630–641 (2017).
Cui, L. et al. Genetic diversity and multiple infections of Plasmodium vivax malaria in Western Thailand. Am. J. Trop. Med. Hyg. 68, 613–619 (2003).
Carlton, J. M. et al. Comparative genomics of the neglected human malaria parasite Plasmodium vivax. Nature 455, 757–763 (2008).
Auburn, S. et al. A new Plasmodium vivax reference sequence with improved assembly of the subtelomeres reveals an abundance of pir genes. Wellcome Open Res. 1, 4 (2016).
Balaji, S., Babu, M. M., Iyer, L. M. & Aravind, L. Discovery of the principal specific transcription factors of Apicomplexa and their implication for the evolution of the AP2-integrase DNA binding domains. Nucleic Acids Res. 33, 3994–4006 (2005).
Painter, H. J., Campbell, T. L. & Llinás, M. The Apicomplexan AP2 family: integral factors regulating Plasmodium development. Mol. Biochem. Parasitol. 176, 1–7 (2011).
Bozdech, Z. et al. The transcriptome of Plasmodium vivax reveals divergence and diversity of transcriptional regulation in malaria parasites. Proc. Natl. Acad. Sci. U. S. A. 105, 16290–16295 (2008).
Hoo, R. et al. Integrated analysis of the Plasmodium species transcriptome. EBio Med. 7, 255–266 (2016).
Zhu, L. et al. New insights into the Plasmodium vivax transcriptome using RNA-Seq. Sci. Rep. 6, 20498 (2016).
Kim, A. et al. Characterization of P vivax blood stage transcriptomes from field isolates reveals similarities among infections and complex gene isoforms. Scientific Reports 7, 1–12 (2017).
Kim, A., Popovici, J., Menard, D. & Serre, D. Plasmodium vivax transcriptomes reveal stage-specific chloroquine response and differential regulation of male and female gametocytes. Nat. Commun. 10, 371 (2019).
Rangel, G. W. et al. Plasmodium vivax transcriptional profiling of low input cryopreserved isolates through the intraerythrocytic development cycle. PLoS Negl. Trop. Dis. 14, e0008104 (2020).
Gunalan, K. et al. Transcriptome profiling of Plasmodium vivax in Saimiri monkeys identifies potential ligands for invasion. In: Proceedings of the National Academy of Sciences 201818485 (2019).https://doi.org/10.1073/pnas.1818485116.
Horuk, R. et al. A receptor for the malarial parasite Plasmodium vivax: the erythrocyte chemokine receptor. Science 261, 1182–1184 (1993).
Galinski, M. R., Medina, C. C., Ingravallo, P. & Barnwell, J. W. A reticulocyte-binding protein complex of Plasmodium vivax merozoites. Cell 69, 1213–1226 (1992).
Cantor, E. M. et al. Plasmodium vivax: functional analysis of a highly conserved PvRBP-1 protein region. Mol. Biochem. Parasitol. 117, 229–234 (2001).
Rodríguez, L. E. et al. Plasmodium vivax MSP-1 peptides have high specific binding activity to human reticulocytes. Vaccine 20, 1331–1339 (2002).
Chappell, L. et al. Refining the transcriptome of the human malaria parasite Plasmodium falciparum using amplification-free RNA-seq. BMC Genom. 21, 395 (2020).
Llinás, M., Bozdech, Z., Wong, E. D., Adai, A. T. & DeRisi, J. L. Comparative whole genome transcriptome analysis of three Plasmodium falciparum strains. Nucleic Acids Res. 34, 1166–1173 (2006).
Siegel, T. N. et al. Strand-specific RNA-Seq reveals widespread and developmentally regulated transcription of natural antisense transcripts in Plasmodium falciparum. BMC Genom. 15, 150 (2014).
Marquez, Y., Höpfler, M., Ayatollahi, Z., Barta, A. & Kalyna, M. Unmasking alternative splicing inside protein-coding exons defines exitrons and their role in proteome plasticity. Genome Res. 25, 995–1007 (2015).
Cunningham, D., Lawton, J., Jarra, W., Preiser, P. & Langhorne, J. The pir multigene family of Plasmodium: antigenic variation and beyond. Mol. Biochem. Parasitol. 170, 65–73 (2010).
Rovira-Graells, N. et al. Transcriptional variation in the malaria parasite Plasmodium falciparum. Genome Res. 22, 925–938 (2012).
Gunalan, K., Niangaly, A., Thera, M. A., Doumbo, O. K. & Miller, L. H. Plasmodium vivax infections of duffy-negative erythrocytes: historically undetected or a recent adaptation?. Trends Parasitol. 34, 420–429 (2018).
Niang, M. et al. Asymptomatic Plasmodium vivax infections among Duffy-negative population in Kedougou, Senegal. Trop. Med. Health 46, 45 (2018).
Ntumngia, F. B. et al. A novel erythrocyte binding protein of Plasmodium vivax suggests an alternate invasion pathway into duffy-positive reticulocytes. MBio 7, 01261-16 (2016).
Rice, B. L. et al. The origin and diversification of the merozoite surface protein 3 (msp3) multi-gene family in Plasmodium vivax and related parasites. Mol. Phylogenet. Evol. 78, 172–184 (2014).
Neafsey, D. E. et al. The malaria parasite Plasmodium vivax exhibits greater genetic diversity than Plasmodium falciparum. Nat. Genet. 44, 1046–1050 (2012).
Cortés, A., Crowley, V. M., Vaquero, A. & Voss, T. S. A view on the role of epigenetics in the biology of malaria parasites. PLoS Pathog. 8, e1002943 (2012).
Ruiz, J. L. et al. Characterization of the accessible genome in the human malaria parasite Plasmodium falciparum. Nucleic Acids Res. 46, 9414–9431 (2018).
Fernandez-Becerra, C. et al. Variant proteins of Plasmodium vivax are not clonally expressed in natural infections. Mol. Microbiol. 58, 648–658 (2005).
Kozarewa, I. et al. Amplification-free Illumina sequencing-library preparation facilitates improved map** and assembly of (G+C)-biased genomes. Nat. Methods 6, 291–295 (2009).
Hester, J. et al. De novo assembly of a field isolate genome reveals novel Plasmodium vivax erythrocyte invasion genes. PLoS Negl. Trop. Dis. 7, e2569 (2013).
Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14, R36 (2013).
Carver, T. et al. BamView: visualizing and interpretation of next-generation sequencing read alignments. Brief Bioinform. 14, 203–212 (2013).
Rutherford, K. et al. Artemis: sequence visualization and annotation. Bioinformatics 16, 944–945 (2000).
Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
Aurrecoechea, C. et al. PlasmoDB: a functional genomic database for malaria parasites. Nucleic Acids Res. 37, D539–D543 (2009).
Hu, G. et al. Transcriptional profiling of growth perturbations of the human malaria parasite Plasmodium falciparum. Nat. Biotechnol. 28, 91–98 (2010).
Acknowledgements
The authors would like to thank Thomas D. Otto for help regarding the PvP01 reference genome, Liam Prestwood for help with transport of samples and Mandy Sanders for help with sequencing submissions. The authors would also like to thank the staff of WSI Bespoke DNA pipelines team for their contribution. Funding support was provided by National Institutes of Health/NIAID (R01AI137154), the Intramural Program of the National Institute of Allergy and Infectious Diseases (National Institutes of Health) and the Wellcome Trust (206194/Z/17/Z).
Author information
Authors and Affiliations
Contributions
S.V.S. and L.C. performed data analysis, interpreted results and wrote the manuscript. J.B.H. purified the schizonts and extracted the RNA. J.B.H. and L.C. performed the RNA-seq library construction. C.A. and S.S. collected samples in field sites and prepared the blood samples in RNAlater. U.C.B. updated annotation of the gene models using the RNA-seq data. M.B., R.M.F. and J.C.R. contributed to manuscript writing and interpretation of results.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Siegel, S.V., Chappell, L., Hostetler, J.B. et al. Analysis of Plasmodium vivax schizont transcriptomes from field isolates reveals heterogeneity of expression of genes involved in host-parasite interactions. Sci Rep 10, 16667 (2020). https://doi.org/10.1038/s41598-020-73562-7
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-020-73562-7
- Springer Nature Limited