SpringerLink
Log in

Differential gene expression analysis using RNA sequencing: retinal pigment epithelial cells after exposure to continuous-wave and subthreshold micropulse laser

  • Laboratory Investigation
  • Published:
Japanese Journal of Ophthalmology Aims and scope Submit manuscript

Abstract

Purpose

Subthreshold micropulse laser (SMPL) is more clinically efficient for the treatment of diabetic macular edema (DME) than the conventional continuous-wave (CW) laser. We aimed to characterize transcriptome changes after the application of these lasers and to compare the transcripts.

Methods

Human pluripotent stem cell-derived retinal pigment epithelial cells were exposed to laser irradiation. Differentially expressed genes (DEGs), distribution of heat shock protein (Hsp) family, gene expression profile, and gene ontology (GO) enrichment analysis based on RNA sequencing data were investigated at 3 h and 24 h after irradiation.

Results

CW laser induced more DEGs than SMPL (1771 vs. 520 genes). The expression of the Hsp family was confirmed in both groups: however, the induction patterns was different for different genes. GO enrichment analysis revealed that CW laser upregulated the expression of DEGs involved in vasculature development (GO: 0001944), related to apoptosis and repair after cell injury whereas SMPL upregulated the expression of DEGs involved in photoreceptor cell maintenance (GO: 0045494), photoreceptor cell development (GO: 0042461), and sensory perception of light stimuli (GO: 0050953).

Conclusions

The results provide insights into the genetic responses and may contribute to the understanding of the molecular mechanisms of laser-induced thermal effects.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Subscribe and save

Springer+ Basic
EUR 32.99 /Month
  • Get 10 units per month
  • Download Article/Chapter or Ebook
  • 1 Unit = 1 Article or 1 Chapter
  • Cancel anytime
Subscribe now

Buy Now

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2

Similar content being viewed by others

References

  1. Photocoagulation for diabetic macular edema. Early Treatment Diabetic Retinopathy Study report number 1. Early Treatment Diabetic Retinopathy Study research group. Arch Ophthalmol. 1985;103:1796–806.

    Article  Google Scholar 

  2. Schatz H, Madeira D, McDonald HR, Johnson RN. Progressive enlargement of laser scars following grid laser photocoagulation for diffuse diabetic macular edema. Arch Ophthalmol. 1991;109:1549–51.

    Article  CAS  PubMed  Google Scholar 

  3. Guyer DR, D’Amico DJ, Smith CW. Subretinal fibrosis after laser photocoagulation for diabetic macular edema. Am J Ophthalmol. 1992;113:652–6.

    Article  CAS  PubMed  Google Scholar 

  4. Writing Committee for the Diabetic Retinopathy Clinical Research N, Fong DS, Strauber SF, Aiello LP, Beck RW, Callanan DG, et al. Comparison of the modified Early Treatment Diabetic Retinopathy Study and mild macular grid laser photocoagulation strategies for diabetic macular edema. Arch Ophthalmol. 2007;125:469–80.

    Article  Google Scholar 

  5. Hudson C, Flanagan JG, Turner GS, Chen HC, Young LB, McLeod D. Influence of laser photocoagulation for clinically significant diabetic macular oedema (DMO) on short-wavelength and conventional automated perimetry. Diabetologia. 1998;41:1283–92.

    Article  CAS  PubMed  Google Scholar 

  6. Mitchell P, Bandello F, Schmidt-Erfurth U, Lang GE, Massin P, Schlingemann RO, et al. The RESTORE study: ranibizumab monotherapy or combined with laser versus laser monotherapy for diabetic macular edema. Ophthalmology. 2011;118:615–25.

    Article  PubMed  Google Scholar 

  7. Ishibashi T, Li X, Koh A, Lai TY, Lee FL, Lee WK, et al. The REVEAL Study: Ranibizumab Monotherapy or Combined with Laser versus Laser Monotherapy in Asian Patients with Diabetic Macular Edema. Ophthalmology. 2015;122:1402–15.

    Article  PubMed  Google Scholar 

  8. Friberg TR, Karatza EC. The treatment of macular disease using a micropulsed and continuous wave 810-nm diode laser. Ophthalmology. 1997;104:2030–8.

    Article  CAS  PubMed  Google Scholar 

  9. Terasaki H, Ogura Y, Kitano S, Sakamoto T, Murata T, Hirakata A, et al. Management of diabetic macular edema in Japan: a review and expert opinion. Jpn J Ophthalmol. 2018;62:1–23.

    Article  PubMed  Google Scholar 

  10. Lai FHP, Chan RPS, Lai ACH, Tsang S, Woo TTY, Lam RF, et al. Comparison of two-year treatment outcomes between subthreshold micropulse (577 nm) laser and aflibercept for diabetic macular edema. Jpn J Ophthalmol. 2021;65:680–8.

    Article  CAS  PubMed  Google Scholar 

  11. Takatsuna Y, Yamamoto S, Nakamura Y, Tatsumi T, Arai M, Mitamura Y. Long-term therapeutic efficacy of the subthreshold micropulse diode laser photocoagulation for diabetic macular edema. Jpn J Ophthalmol. 2011;55:365–9.

    Article  CAS  PubMed  Google Scholar 

  12. Inagaki K, Ohkoshi K, Ohde S, Deshpande GA, Ebihara N, Murakami A. Comparative efficacy of pure yellow (577-nm) and 810-nm subthreshold micropulse laser photocoagulation combined with yellow (561–577-nm) direct photocoagulation for diabetic macular edema. Jpn J Ophthalmol. 2015;59:21–8.

    Article  CAS  PubMed  Google Scholar 

  13. Qiao G, Guo HK, Dai Y, Wang XL, Meng QL, Li H, et al. Sub-threshold micro-pulse diode laser treatment in diabetic macular edema: a Meta-analysis of randomized controlled trials. Int J Ophthalmol. 2016;9:1020–7.

    PubMed  PubMed Central  Google Scholar 

  14. Luttrull JK, Musch DC, Mainster MA. Subthreshold diode micropulse photocoagulation for the treatment of clinically significant diabetic macular oedema. Br J Ophthalmol. 2005;89:74–80.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Lavinsky D, Cardillo JA, Melo LA Jr, Dare A, Farah ME, Belfort R Jr. Randomized clinical trial evaluating mETDRS versus normal or high-density micropulse photocoagulation for diabetic macular edema. Invest Ophthalmol Vis Sci. 2011;52:4314–23.

    Article  PubMed  Google Scholar 

  16. Chen G, Tzekov R, Li W, Jiang F, Mao S, Tong Y. Subthreshold micropulse diode laser versus conventional laser photocoagulation for diabetic macular edema: a meta-analysis of randomized controlled trials. Retina. 2016;36:2059–65.

    Article  CAS  PubMed  Google Scholar 

  17. Figueira J, Khan J, Nunes S, Sivaprasad S, Rosa A, de Abreu JF, et al. Prospective randomised controlled trial comparing sub-threshold micropulse diode laser photocoagulation and conventional green laser for clinically significant diabetic macular oedema. Br J Ophthalmol. 2009;93:1341–4.

    Article  CAS  PubMed  Google Scholar 

  18. Ohkoshi K, Yamaguchi T. Subthreshold micropulse diode laser photocoagulation for diabetic macular edema in Japanese patients. Am J Ophthalmol. 2010;149:133–9.

    Article  PubMed  Google Scholar 

  19. Whitley D, Goldberg SP, Jordan WD. Heat shock proteins: a review of the molecular chaperones. J Vasc Surg. 1999;29:748–51.

    Article  CAS  PubMed  Google Scholar 

  20. Inagaki K, Shuo T, Katakura K, Ebihara N, Murakami A, Ohkoshi K. Sublethal photothermal stimulation with a micropulse laser induces heat shock protein expression in ARPE-19 cells. J Ophthalmol. 2015;2015: 729792.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Inagaki K, Hamada M, Ohkoshi K. Minimally invasive laser treatment combined with intravitreal injection of anti-vascular endothelial growth factor for diabetic macular oedema. Sci Rep. 2019;9:7585.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Tripathi S, Pohl MO, Zhou Y, Rodriguez-Frandsen A, Wang G, Stein DA, et al. Meta- and orthogonal integration of influenza “OMICs” data defines a role for UBR4 in virus budding. Cell Host Microbe. 2015;18:723–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Tababat-Khani P, de la Torre C, Canals F, Bennet H, Simo R, Hernandez C, et al. Photocoagulation of human retinal pigment epithelium in vitro: unravelling the effects on ARPE-19 by transcriptomics and proteomics. Acta Ophthalmol. 2015;93:348–54.

    Article  CAS  PubMed  Google Scholar 

  24. Lavinsky D, Wang J, Huie P, Dalal R, Lee SJ, Lee DY, et al. Nondamaging retinal laser therapy: rationale and applications to the macula. Invest Ophthalmol Vis Sci. 2016;57:2488–500.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Wang J, Quan Y, Dalal R, Palanker D. Comparison of continuous-wave and micropulse modulation in retinal laser therapy. Invest Ophthalmol Vis Sci. 2017;58:4722–32.

    Article  CAS  PubMed  Google Scholar 

  26. Kern K, Mertineit CL, Brinkmann R, Miura Y. Expression of heat shock protein 70 and cell death kinetics after different thermal impacts on cultured retinal pigment epithelial cells. Exp Eye Res. 2018;170:117–26.

    Article  CAS  PubMed  Google Scholar 

  27. Friday BB, Adjei AA. Advances in targeting the Ras/Raf/MEK/Erk mitogen-activated protein kinase cascade with MEK inhibitors for cancer therapy. Clin Cancer Res. 2008;14:342–6.

    Article  CAS  PubMed  Google Scholar 

  28. van der Noll R, Leijen S, Neuteboom GH, Beijnen JH, Schellens JH. Effect of inhibition of the FGFR-MAPK signaling pathway on the development of ocular toxicities. Cancer Treat Rev. 2013;39:664–72.

    Article  PubMed  Google Scholar 

  29. Kyriakis JM, Avruch J. Mammalian MAPK signal transduction pathways activated by stress and inflammation: a 10-year update. Physiol Rev. 2012;92:689–737.

    Article  CAS  PubMed  Google Scholar 

  30. Yao B, Wang S, **ao P, Wang Q, Hea Y, Zhang Y. MAPK signaling pathways in eye wounds: multifunction and cooperation. Exp Cell Res. 2017;359:10–6.

    Article  CAS  PubMed  Google Scholar 

  31. Tababat-Khani P, Berglund LM, Agardh CD, Gomez MF, Agardh E. Photocoagulation of human retinal pigment epithelial cells in vitro: evaluation of necrosis, apoptosis, cell migration, cell proliferation and expression of tissue repairing and cytoprotective genes. PLoS ONE. 2013;8: e70465.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Wu H, Wang G, Li S, Zhang M, Li H, Wang K. TNF-alpha- mediated-p38-dependent signaling pathway contributes to myocyte apoptosis in rats subjected to surgical trauma. Cell Physiol Biochem. 2015;35:1454–66.

    Article  CAS  PubMed  Google Scholar 

  33. ElKeeb AM, Collier ME, Maraveyas A, Ettelaie C. Accumulation of tissue factor in endothelial cells induces cell apoptosis, mediated through p38 and p53 activation. Thromb Haemost. 2015;114:364–78.

    Article  CAS  PubMed  Google Scholar 

  34. Maeshima K, Utsugi-Sutoh N, Otani T, Kishi S. Progressive enlargement of scattered photocoagulation scars in diabetic retinopathy. Retina. 2004;24:507–11.

    Article  PubMed  Google Scholar 

  35. Pan L, Zhao Y, Yuan Z, Qin G. Research advances on structure and biological functions of integrins. Springerplus. 2016;5:1094.

    Article  PubMed  PubMed Central  Google Scholar 

  36. Blandin AF, Noulet F, Renner G, Mercier MC, Choulier L, Vauchelles R, et al. Glioma cell dispersion is driven by alpha5 integrin-mediated cell-matrix and cell-cell interactions. Cancer Lett. 2016;376:328–38.

    Article  CAS  PubMed  Google Scholar 

  37. De Cilla S, Vezzola D, Farruggio S, Vujosevic S, Clemente N, Raina G, et al. The subthreshold micropulse laser treatment of the retina restores the oxidant/antioxidant balance and counteracts programmed forms of cell death in the mice eyes. Acta Ophthalmol. 2019;97:e559–67.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

This work was supported by JSPS KAKENHI (Grants-in-Aid for Scientific Research) Grant Number 19K18872. Professional medical English editing was done by Editage.

Author information

Authors and Affiliations

  1. Department of Ophthalmology, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, Japan

    Tomoyasu Shiraya, Fumiyuki Araki, Suguru Nakagawa, Takashi Ueta, Kiyohito Totsuka, Taku Toyama, Koichiro Sugimoto & Satoshi Kato

  2. NIDEK CO., LTD., Gamagori, Japan

    Hitoshi Abe & Yasuyuki Naito

Authors
  1. Tomoyasu Shiraya
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Fumiyuki Araki
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Suguru Nakagawa
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Takashi Ueta
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Kiyohito Totsuka
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Hitoshi Abe
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Yasuyuki Naito
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Taku Toyama
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Koichiro Sugimoto
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Satoshi Kato
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Satoshi Kato.

Ethics declarations

Conflicts of interest

T. Shiraya, None; F. Araki, None; S. Nakagawa, None; T. Ueta, None; K. Totsuka, None; H. Abe, None; Y. Naito, None; T. Toyama, None; K. Sugimoto, None; S. Kato, None.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Corresponding author: Satoshi Kato

Supplementary Information

Below is the link to the electronic supplementary material.

10384_2022_925_MOESM1_ESM.tif

Supplementary file1 Supplementary material. Experimental setup for laser irradiation of human pluripotent stem cell-derived RPE cells. a. The figure shows RPE cells immediately after irradiation with CW laser at a power ranging from 100 to 300 mW. Lesions formed by CW laser provided at a power ranging from 140 to 160 mW are ophthalmoscopically visible (arrowheads). The bottom row shows intentional burns, which are used to identify the irradiation site at each power. Cell viability was assessed using a LIVE/DEADTM Cell Imaging kit. Live cells were able to hydrolyze calcein-AM and were therefore stained green, while dead cells were permeable to ethidium homodimer-1 and were therefore stained red. b. Results of cell viability assay after two hours of CW laser irradiation are shown in Figure (a). Interestingly, cell death was also observed at 100-130 mW, where no coagulation spots were observed. c. Cell viability assay after two hours of SMPL irradiation revealed, no cellular death below 300-mW exposure, minimal cellular death at 400 mW and obvious cellular death at 500 mW. The bottom row shows intentional burns, which are used to identify the irradiation site at each power. d. Quantitative analysis showed that the expression of Hsp70 mRNA (n = 3) increased over baseline at 300 and 500 mW. **p < 0.01 compared to the non-irradiated control. The primers for Hsp70 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were as follows: forward (ATGTCGGTGGTGGGCATAGA), reverse (CACAGCGACGTAGCAGCTCT); forward (GAGTCAACGGATTTGGTCGT), reverse (TTGATTTTGGAGGGATCTCG). Abbreviations: CW, continuous-wave; SMPL, subthreshold micropulse laser; Hsp, heat shock protein (TIF 2505 KB)

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Shiraya, T., Araki, F., Nakagawa, S. et al. Differential gene expression analysis using RNA sequencing: retinal pigment epithelial cells after exposure to continuous-wave and subthreshold micropulse laser. Jpn J Ophthalmol 66, 487–497 (2022). https://doi.org/10.1007/s10384-022-00925-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s10384-022-00925-0

Keywords

Search

Navigation