Background

In angiosperms, flowering-time is a crucial part of the plant life cycle, providing a critical developmental switch from the vegetative growth to the reproductive stage to ensure seed production required for the survival of plant [1]. Floral development and flowering-time is regulated by a complex networks of genetic and epigenetic reprogramming [photoperiod, autonomous, vernalization/temperature, gibberellin (GA), and sucrose pathways] to ensure that flowering-time has coincided with suitable conditions for fertilization and seed dispersal [2,3,4,5,6,7]. This genetic and epigenetic reprogramming is attained by explicit control of the expression of key flowering genes at both transcriptional and post-transcriptional level in response to developmental and environmental stimuli [3, 4]. In this context, microRNAs (miRNAs), a class of small, single-stranded, non-coding RNAs ranging from 19 to 25 nucleotides (nt) in length, have recently been identified as crucial regulators of gene expression through transcript cleavage and translational inhibition of target genes involved in the floral transition, floral patterning and development of floral organs [8,9,10,11,12,13,14,15]. However, the biological functions of these miRNAs have been characterized mainly in model plants [16, 25, 26]. Therefore, characterization of ARF members and their roles in floral development in different plant species are crucial.

Over the last decades, there has been a considerable increase in the economic importance of grape production for direct berry consumption and beverage production [27]. There are several reports demonstrated that the developmental process of grape flower affects berry fruiting type, yield and quality [28]. Therefore, the molecular regulatory mechanisms of grape flower development are essential to be determined. In our recent study, grapevine berries-treated with GA3 exhibited a significant up-regulation in several miRNA families in floral tissues, including miR159s and miR160s, suggesting a potential role of these miRNAs in GA signaling [29]. The potential role of VvmiR159c in GA signaling through GA-DELLA [SLENDER RICE 1 (SLR1)]-VvmiR159c-VvGAMYB as a key molecular module for seedless grapevine development has recently been reported by our group [15]. However, the molecular mechanisms of miR160 and their specific target genes on modulating grape flower and parthenocarpy development remain elusive. In this context, we first examined the morphological changes in ‘Rosario Bianco’ cultivar during flower and berry development in response to GA3 treatment. Secondly, we isolated and cloned the precise sequences of VvmiR160a/b/c/d/e in the floral tissues of grape cv. ‘Rosario Bianco’. Thirdly, their ARF target genes were predicted by using VvmiR160a/b/c/d/e sequences, together with updated grape mRNA database. The identified VvARFs were further characterized for their phylogenetic relationship and sequence homology with other ARFs derived from various plant species. The promoter motifs responsive to hormones including GA inVvMIR160s (VvmiR160 precursors) and VvARFs were analyzed, which was confirmed during our experiments. Finally, the cleavage role and cleavage sites of the different VvmiR160 members and their VvARF10/16/17target genes were verified in grape flowers by RNA-ligase-mediated Rapid Amplification of cDNA Ends (RLM-RACE) and Poly (A) polymerase -mediated 3′ rapid amplification of cDNA ends (PPM-RACE). In addition, the temporal-spatio expression and cleavage product accumulation of VvmiR160a/b/c/d/e and VvARF10/16/17 target genes in response to GA application during grape development were investigated. Our results demonstrated that VvmiR160 modulates GA-mediated floral developmental and grapevine parthenocarpic regulation via its negative regulation of VvARF activity.

Results

Morphological changes of the floral and berry development during grapevine parthenocarpic process-induced by exogenous GA treatment

To investigate the effect of GA3 on grapevine floral development and parthenocarpy process, we compared the floral clusters and berries morphology of GA3-treated ‘Rosario Bianco’ grapevine cultivar relative to untreated control plants (CK) at different time points [0 h, 2 h, 1 , 5 , 9 , 10 , 45 and 95 days after treatment (0HAT, 2HAT, 1DAT, 5DAT, 9DAT, 10DAT, 45DAT and 95DAT respectively)] (Fig. 1a and b). Out of them, GA treatment was performed at 21 days after inflorescence, and the GA-treated plants reached anthesis at 9 DAT, while the control plants did not. As shown in Fig. 1a and b, the GA3-treated plants exhibited a significant early anthesis and a remarkable increase in the length of spikes at 5DAT and 9DAT in comparison with untreated control plants (Fig. 1b). The GA3-treated inflorescences start opening on the 5DAT, while the control inflorescences remained closed (Fig. 1a). After peeling off buds for further observation, an obvious effect of GA3 treatment on ‘Rosario Bianco’ grapevine inflorescence was strongly observed on 5DAT and 9DAT with distinct floral morphology, including dark yellow and small anthers, long filaments, short styluses and big ovaries relative to untreated control plants (Fig. 1a). In addition, GA3-treated grapevine berries exhibited the long berry spikes and grains in contrast with control ones (Fig. 1b), and the high seedless ratio (96.2%) relative to control plants (~ 5%) (Fig. 1a), suggesting that GA3 treatment possessed the significant effect in inducing ‘Rosario Bianco’ grapevine parthenocarpy.

Fig. 1
figure 1

Morphological changes of the floral and berry development during grapevine parthenocarpy process-induced by exogenous gibberellin (GA) application. a Morphological changes of ‘Rosario Bianco’ cultivar during flower and berry development in response to GA3 treatment at different time points [0 h, 2 h, 1 day, 5 , 9 , 10 , 45 and 95 days after treatment (0HAT, 2HAT, 1DAT, 5DAT, 9DAT, 10DAT, 45DAT and 95DAT, respectively)]. b Effect of GA3 on the length and width of grape spikes. Values are means ± standard errors (SEs) of three independent biological replicates (n = 10). Asterisks indicate a significant difference between GA-treated plants and respective untreated control (CK) plants at each time point as determined by Student’s t-test (*P < 0.05; **P < 0.01)

Full size image

Determination of the precise sequences of VvmiR160s in the floral tissues of grape cv. ‘Rosario Bianco’ by miR-RACE

In this study, we employed miR-RACE technology to determine the precise sequences of VvmiR160 family members in the floral tissues of grapevine cv. ‘Rosario Bianco’ (Fig. 2a and b). The PCR products of 3′- and 5′-miR-RACE for VvmiR160a/b/c/d/e members were ~ 88 and 62 bp, respectively (Fig. 2a). All the miR-RACE PCR products were validated by subsequent cloning and sequencing. The sequence identity between our cloned sequences and validated miRNA in miRBase 21.0 was used to confirm the precision of the 3′- and 5′-miR-RACE technique. VvmiR160a and VvmiR160b were identical both in length (21 nt) and nucleotide sequence “TGCCTGGCTCCCTGAATGCCA”, with 14.2; 23.8; 23.8 and 38.0 percentage composition of A, T, G, and C, respectively (Fig. 2b). Whereas, VvmiR160c, VvmiR160d and VvmiR160e shared identical length and sequence “TGCCTGGCTCCCTGTATGCCA”, with 9,5; 28,5; 23,8 and 38,0 percentage composition of A, T, G and C, respectively (Fig. 2b). The more GC content in the VvmiR160s is important for stabilization of the stem-loop hairpin structure. Both VvmiR160a/b and VvmiR160c/d/e exhibited high sequence similarity with one base variation (A/T) at the 15th site from the 5′-end (Fig. 2b). The primary transcripts of VvmiR160a/b/c/d/e (VvMIR160a-e) were cloned and sequenced, demonstrating that their lengths were about 501 bp (Fig. 2a), which were further used for secondary hairpin structure formation using Mfold online tool (http://unafold.rna.albany.edu/). These results confirmed the authenticity of VvmiR160a/b/c/d/e, and all VvmiR160a/b/c/d/e members were located in the 5′-stem arm of their precursor’s loop-stem structures (Fig. 2c), suggesting that various members of VvmiR160 family possess a conserved position at their precursors.

Fig. 2
figure 2

Mature sequences of VvmiR160s and the secondary structures of their precursors. a The PCR products of 3′-miR-RACE and 5′-miR-RACE for VvmiR160a/b/c/d/e, respectively, and the cloning of their primary sequences. b Comparison of our cloned VvmiR160s precise sequences with the homologous sequences in grapes from MiRBase. c The secondary structures of VvmiR160s precursors, where red frames indicate the mature sequences of VvmiR160s at the 5′-end arms of their precursor structures

Full size image

Identification, characterization and chromosomal distribution of VvARF genes

Based on our identified sequences of VvmiR160s and the updated grape mRNA database (GRAPE_IGGP 12X assembly - v2 annotation), we employed the psRNATarget software (http://plantgrn.noble.org/psRNATarget/#) to re-predict the specific target genes of VvmiR160s following the rules of target prediction as reported by Wang [30]. VvARF10/16/17 were identified as the candidate target genes of VvmiR160s (Additional file 1: Figure S1), and all target regions of VvmiR160s occurred in the coding sequence (CDS) of the corresponding VvARF target genes, and their interaction modes were cleaved (Table 1). Next, the complementary degree of VvmiR160:VvARF pairs exhibited some divergence, for example,VvmiR160a/b and their VvARF16 target genes have three mismatch bases, while VvmiR160c/d/e displayed only one mismatch base with VvARF16 (Fig. 3a), indicating some divergence in their cleavage roles. Also, high conservation at the sites with mismatch bases between VvmiR160s and VvARFs was observed (Fig. 3a), which might be one of the reasons for the conservation of target modes for VvmiR160s. All VvmiR160s and their VvARF target gene sequences were further mapped in grapevine chromosomes (Chrs) using MapInspect software (http://www.plantbreeding.wur.nl/uk/software-mapinspect.html). All five VvmiR160s and three VvARFs identified in this study were distributed over four of the 19 grapevine chromosomes (Fig. 3b). Chr 10 contained two VvmiR160 members, whereas Chr 8, 12 and 13 contained only one VvmiR160 member (Fig. 3b). Map** results demonstrated that VvmiR160a, VvmiR160d, and VvmiR160e are located on Chr 12, 8, 13 respectively, while both VvmiR160b and VvmiR160c were mapped into the same position on Chr 10 (Fig. 3b). In addition, VvARF10, VvARF16, and VvARF17 were mapped on Chr 8, 13 and 18, respectively (Fig. 3b). VvmiR160d:VvARF10 and VvmiR160e:VvARF16 pairs were located in the same position on Chr 8 and 13, respectively, whereas there is no co-localization of miR160s with VvARF17 on Chr 18 (Fig. 3b). Whether this chromosome neighboring of VvmiR160s and VvARFs might affect their cleavage activity, this needs further investigation.

Table 1 Prediction of VvmiR160 target genes by bioinformatics
Full size table
Fig. 3
figure 3

Complementary degree and distribution of VvmiR160s and their VvARF targeted genes on grapevine chromosomes. a The complementary degree of VvmiR160s and their potential VvARF target genes. ‘X’ represents complementary mismatch, and ‘O’ represents the 0.5 mismatches. b The distribution of VvmiR160s and VvARFs on grapevine chromosomes. The chromosome numbers and sizes (Mb) are indicated at the top and bottom of each bar, respectively

Full size image

Identification of VvARFs and phylogenetic and diversified analyses of their orthologous sequences across diverse plant species

We cloned the three predicted VvARF10/16/17 gene sequences in ‘Rosario Bianco’ grapevine flowers, and their deduced amino acid sequences were identified (Additional file 2: Figure S2). The open reading frame (ORF) of VvARF10 was 2106 bp encoding 701 amino acid residues, VvARF16 exhibited 2052 bp encoding 683 amino acid residues, while VvARF17 possessed 1653 bp encoding 550 amino acid residues (Additional file 2: Figure S2). To study the phylogenetic relationships between the members of ARF family, an unrooted tree was constructed from an alignment of protein sequences of VvARF10/16/17 and their orthologous from different plant species by using Neighbour-joining method (Fig. 4a). Phylogenetic analysis reveals diversification and conservation of ARFs among different plant species (Fig. 4a). All the ARF family members fell into two major groups represented by 27 accessions (Fig. 4a). Group I contained all ARF10 and ARF16 classes, whereas group II contained all ARF17 class (Fig. 4a). The phylogenetic relationship between our VvARFs and orthologues one derived from NCBI demonstrated that VvARF16 has a close phylogenetic relationship with Arabidopsis (AtARF16), while VvARF10 and VvARF17 exhibited the closest relation to walnut (Juglans regia, JrARF10, and JrARF17, respectively), indicating a conserved nature of ARF family members among diverse plant species. On the other hand, VvARF10/16/17 have a distance phylogenetic relationship with cherry (Prunus avium, PaARFs) and peach (Prunus persica, PpARFs), indicating the diversification of evolution in diverse members of ARF protein family (Fig. 4a).

Fig. 4
figure 4

The phylogenetic relationship, exon-intron organization, and conserved domain analyses among the grapevine ARF proteins and their orthologous sequences across different plant species. a The unrooted tree was generated using MEGA 7.0.21 program by neighbor-joining method. Bootstrap values from 1000 replicates are indicated at each branch. b The exon-intron composition of ARF genes. The coding (CDS) and up−/down-stream regions are represented by red and blue boxes, respectively. Lines represent the introns. c Conserved domains in ARF proteins determined by searching the ARF protein sequences in NCBI Conserved Domain Database. B3: plant-specific B3-DNA binding domain, Auxin_resp: a conserved region of an auxin-responsive factor, AUX_IAA: C-terminal AUX_IAA domain. d The conserved motifs of ARF proteins in nine species were performed using the MEME program and arranged corresponding to the phylogenetic tree. Different motifs are highlighted with different color boxes and numbers. The length of boxes corresponded to motif length

Full size image

Analysis of the exon-intron structure of the three VvARF full-length cDNA sequences with the corresponding genomic DNA sequences showed that several members of VvARF-CDS are disrupted by one to three introns (Fig. 4b). The maximum number of introns was detected in ARF10/16 members, while the lowest was detected in ARF17 (Fig. 4b). All the ARF members exhibited similar gene structures of intron position and length similar to their phylogenetic tree, which supports the reliability of the phylogenetic analysis (Fig. 4b). Three conserved domains (B3, AUX_rsep, and AUX_IAA) were identified, and their distribution in the proteins of respective ARFs in the phylogenetic tree has been presented (Fig. 4c). All the ARF proteins contained two well-conserved DNA binding domains B3 and Auxin_resp at the N-terminus (Fig. 4c). While VvARF16, SlARF10, JrARF10, and JrARF16 had additional AUX_IAA domain in the C-terminus (Fig. 4c), suggesting that ARFs have functional conservation in response to AUX signal in various plant species.

Next, motif composition analysis of ARFs proteins was carried out using the MEME 5.05 tool. The homologous ARFs with more close relationships from the phylogenetic tree possessed the similar motif compositions, and those with more far relationships had the conspicuous difference in their motif compositions (Fig. 4d), implying the more similar structures of homologous ARFs, the more conservation of their functions. Furthermore, the parameters of protein physicochemical properties, including the number of amino acids, the molecular weight, the isoelectric point, the aliphatic index and the grand average of hydropathicity were analyzed (Additional file 3: Table S1). In contrast with the results in Fig. 4a and d, we revealed that although VvARF10 and JrARF10; VvARF16 and AtARF16; VvARF17 and JrARF17, had the close genetic distance in their gene sequences, their parameters in proteins had much more variation. This range of variability indicates that different ARF proteins might operate in various microenvironments [31].

Cis-element analysis of promoters of VvMIR160s and their VvARF target genes

The promoter region is a critical factor for gene expression, and its sequence contains some essential cis-elements (functional components) which could reflect the potential functions of genes [32]. To recognize the possiblefunctions of VvMIR160s and their VvARFs target genes in grapes, we analyzed the cis-elements in their promoters (Additional file 4: Table S2). All cis-elements were classified into five types, including light, hormone, tissue-specific, circadian and stress responsive elements (Fig. 5a). Light-related elements were the most abundant among all five types of motifs in the different VvmiR160 and VvARF members (Fig. 5a), which might be due to the important role of light in the photosynthesis process for plant growth and development. Whereas, the cis-elements responsive stress, hormone, and specific tissues development were also detected; however, their abundance was much lower than those of light responsive cis-element (Fig. 5a). Moreover, there were diverse in the type and number of promoters’ cis-elements of VvMIR160s and their target VvARFs (Fig. 5a and Additional file 4: Table S2), indicating the diversification of various members from the same one family.

Fig. 5
figure 5

Motif analysis of the promoters from the VvMIR160s precursor and their target VvARF genes. a The total number of diverse types of motifs derived from VvMIR160s and VvARFs promoters which are involved in the different biological process. b The proportion of each type of hormone-related elements of VvMIR160s and its VvARF targeted genes respectively. c The percentage of the total amount of the hormone-related cis-elements of VvMIR160s and its VvARF targeted genes respectively

Full size image

To further recognize the possible regulation mechanism of VvmiR160s and their VvARF target genes in response to GA treatmentduring grape flower development, we scanned the hormone-related cis-elements in their promoter regions (Additional file 5: Table S3). Interestingly, we found that almost all VvmiR160 members (except VvmiR160b) and their VvARF10/16/17 target genes, had hormone responsive cis-elements, including indole acetic acid (IAA), GA, methyl jasmonate (MeJA), salicylic acid (SA), abscisic acid (ABA) and ethylene (ET) responsive cis-elements (Fig. 5b). However, both the composition and quantity of cis-elements related to hormones exhibited some variance among different VvmiR160 members and their VvARF target genes (Fig. 5b and c), indicating that their potential functions might possess some unique as well as overlap** functions in grapes. Interestingly, all VvmiR160s (except VvmiR160b) and VvARFs had the common cis-elements responsive to GA and SA, which could be essential hormones for modulating grape flower and berry development. For example, VvmiR160a/c/d/e have cis-elements responsive to GA, among which, VvmiR160a exhibited the highest percentage (37%), while VvmiR160c displayed the lowest (16%). Similarly, VvmiR160d and VvmiR160e exhibited the highest percentage of cis-elements responsive to SA (50 and 33%, respectively) in comparison with VvmiR160a and VvmiR160c (Fig. 5b). Our results supported the significant information for the prediction of the potential functions of VvmiR160:VvARF pairs in the modulation of grape growth and development through responding hormone signals.

In vitro activity of VvMIR160c and VvARF10 promoters in response to GA

A further analysis of the VvMIR160c and VvARF10 promoters were conducted in order to confirm the activity of their promoters in response to GA. The VvMIR160c and VvARF10 promoter regions were fused to the β-glucuronidase (GUS) reporter gene after removal of 35SCaMV promoter in the binary vector pBI121, and the vector constructs are shown in Fig. 6a. The obtained constructs were transformed independently into tobacco plants using the Agrobacterium-mediated method. A pBI121-35S-GUS construct-containing 35SCaMV promoter served as positive control, while pBI101 construct-lacking 35SCaMV promoter served as negative control (Fig. 6b). To validate the presence of GA-related cis-elements in VvMIR160c and VvARF10 promoter regions, 0, 30 and 50 μM GA were applied to the transgenic tobacco lines and the GUS activity was examined. The histochemical staining pattern revealed the effect of the GA treatments on the level of GUS activity in transformed tobacco leaves (Fig. 6b). As expected, the GUS gene driven by the 35SCaMV promoter (positive control) was constitutively expressed in the transformed tobacco leaves under control and GA-treated conditions in comparison with negative control (pBI101 construct-lacking 35SCaMV promoter) transgenic lines (Fig. 6b and c). However, low level of GUS activity driven by the VvMIR160c and VvARF10 promoters 1 and 2 were observed in untreated (0 μM GA) transformed tobacco leaves (Fig. 6b and c). GUS activity increased markedly in VvMIR160c and VvARF10 promoter 1-containing constructs (pBI121-p1VvmiR160c-GUS and pBI121-p1VvARF10-GUS) in the transgenic tobacco leaves-treated with 30 and 50 μM GA, especially at higher dose (50 μM GA) in comparison with the untreated transgenic tobacco leaves (Fig. 6b and c). However, GUS activity almost did not changed in VvMIR160c and VvARF10 promoter 2-containing constructs (pBI121-p2VvmiR160c-GUS and pBI121-p2VvARF10-GUS) in transgenic tobacco leaves treated with 30 and 50 μM GA (Fig. 6b and c). Our data clearly confirmed that VvMIR160c and VvARF10 promoter 1 region with 1500 bp contained GA-related cis-responsive elements, which is essential for inducing GA response.

Fig. 6
figure 6

Functional analyses of the VvMIR160c and VvARF10 promoters. a Schematic diagram of the pBI121-pVvmiR160c/VvARF10-GUS constructs. pBI121-p1VvMIR160c-GUS and pBI121-p1VvARF10-GUS constructs. The 1.5 kb promoter regions of VvMIR160c and VvARF10 were cloned into pBI121 to replace the 35SCaMV promoter and were used to drive the GUS gene. pBI121-p2VvMIR160c-GUS constructs. The 1442 bp promoter fragment region of VvMIR160c without including the GA response element (59–1500 bp) was cloned into pBI121 to replace the 35SCaMV promoter and was used to drive the GUS gene. pBI121-p2VvARF10-GUS constructs. The 937 bp promoter fragment region of VvmiR160c without including the GA response element (564–1500 bp) was cloned into pBI121 to replace the 35SCaMV promoter and was used to drive the GUS gene. b and c Histochemical staining pattern (b) and GUS activity (c) of tobacco leaves in response to different treatments. The fully expanded leaves from 6-week-old tissue culture plants of tobacco were infiltrated with Agrobacterium carrying different constructs. The infiltrated seedlings were then moved back to the environmental chamber and kept in the dark for 3 d. Treatment on tobacco leaves with 30 μM GA and 50 μM GA were performed 2 days later. The uniformly sized leaves were used in infiltration experiment. The presented images of leaves in (b) are representative of the results obtained from three independent experiments. Data shown in (c) represent the mean ± SD of three independent experiments (n = 3). Different letters denote significant differences between the constructs and the treatments (P < 0.05), positive control (pBI121); negative control (pBI101)

Full size image

Verification of VvmiR160-mediated VvARFs cleavage roles by RLM-RACE and PPM-RACE

The interaction between VvmiR160 family members and VvARF target genes, and their regulatory mechanisms in grape floral tissues were investigated by our modified RLM-RACE and developed PPM-RACE procedures [30]. First, from RLM-RACE, the sequencing of the amplified 3′-end products revealed only one cleavage site in the middle of complementary regions of VvmiR160 family members and VvARF10/16/17 (Fig. 7). All the cleavage sites were mapped in the 9th site from the 5′- end of VvmiR160a/b/c/d/e (Fig. 7), indicating the specificity of cleavage sites of miRNAs, which is consistent with previous studies [30, 33, 34]. Next, our developed PPM-RACE was employed to further confirm the target genes of VvmiR160s and their cleavage sites. The sequencing of the amplified 5′-end products identified the same cleavage sites as those of the 3′-end sequencing in the RLM-RACE experiment. In addition, the cleavage frequencies of 5′-end product were less than those of 3′-end product, which might be attributed to the more stability of 3′-end fragments than 5′-end one [30, 33, 34]. The consistent results of both the RLM-RACE and PPM-RACE experiments confirmed that VvARF10, VvARF16, and VvARF17 are the downstream target genes of VvmiR160a/b/c/d/e, and verified their cleavage interaction mode in grapevine inflorescence (Fig. 7). Although the cleavage sites of VvmiR160s were located on the same 9th position from their 5′-ends, these cleavage sites mapped on different positions in the respective VvARF target genes (Fig. 7). For instance, all cleavage sites of VvmiR160s were located at the 9th position from 5′-end of VvmiR160s, but located at the 1337th with 14/14 from the 5′-end for VvARF10, 1304th with 16/16 from the 5′-end for VvARF16 and the 1364th with 22/22 from the 5′-end for VvARF17 (Fig. 7).

Fig. 7
figure 7

Map** of the VvmiR160s-mediated cleavage sites on VvARFs by PPM-RACE and RLM-RACE. The red arrows indicate the cleavage sites of VvmiR160s on VvARFs identified by 5′ and 3′-ends of mRNA fragments cloned by PPM-RACE and RLM-RACE, respectively. The red and blue sequences represent the mature sequences of VvmiR160s and their target region sequences in VvARFs, respectively. Green strip denotes the remaining sequence outside the targeted region

Full size image

Differential expression profiles and correlation analysis of VvmiR160s and VvARFs during grape development

The effect of the interaction between VvmiR160s and VvARFs during grape flower development was examined by measuring the spatio-temporal expression profiles of VvmiR160s and VvARFs under control condition (Fig. 8a). As shown in Fig. 8a, the expression level of VvmiR160 family could be classified into three groups. In group one, VvmiR160a/b/c exhibited the highest expression level during the late stage of floral development [from 22 days after inflorescence (22DAI) to 30DAI], and low expression during the early stage of floral development (Fig. 8a). In addition, VvmiR160a and VvmiR160c exhibited similar expression trend with the highest expression level has been detected at 26DAI, while VvmiR160b possessed the highest level at 30DAI (Fig. 8a). In group two, VvmiR160d exhibited a reverse expression trend relative to VvmiR160a/b/c, with high expression level has been detected at early floral development, followed by a gradual decrease till the late phase of floral development (Fig. 8a). In group three, VvmiR160e showed a low expression level at all stages, suggesting that VvmiR160e might have a slight role during grape floral development (Fig. 8a). Subsequently, the expression profiles of VvmiR160a/b/c exhibited one upward trend along with berry development [from 1 day after anthesis (1DAA) to 86DAA], and reached the high peak till maturation (86DAA); while VvmiR160d exhibited a reverse expression trend relative to VvmiR160a/b/c, and VvmiR160e showed a low expression level at all stages, suggesting that VvmiR160e might also have a slight role during grape berry development (Fig. 8b).

Fig. 8
figure 8

Characterization of VvmiR160:VvARF expression and Pearson correlation analysis during grape flower and berry development. a Characterization of VvmiR160:VvARF expression and Pearson correlation analysis during grape flower development. b Characterization of VvmiR160:VvARF expression and Pearson correlation analysis during grape berry development. The relative expression of VvmiR160a/b/c/d/e and the three VvARF10/16/17 target genes at different stages [21 days after inflorescences (21DAI), 22DAI, 26DAI and 30DAI; 1 day after anthesis (1DAA), 36DAA, 86DAA] of floral and berry development. Pearson correlation coefficient (r) between VvmiR160 and VvARF expression are indicated. Each experiment was repeated three times. ANOVA test was used to identify significant differences, Asterisks indicated statistically significant differences at (*P < 0.05; **P < 0.01; ***P < 0.001) as determined by Student’s t-test

Full size image

All three VvARF10/16/17 target genes exhibited a reverse expression trend in comparison with VvmiR160a/b/c, where their expression levels increased during the early stage of flower/berry development and decreased gradually till the later stage (Fig. 8a and b). However, VvARF10/16/17 expression profiles were similar to VvmiR160d expression during the different stages of grape flower/berry development (Fig. 8a and b). The Pearson correlation coefficient showed that VvARF10/16/17 expression exhibited a highly negative correlations (r = − 0.83 to − 0.94 for flowers; r = − 0.81 to − 1 for berries) with VvmiR160a/b/c and positive correlation (r = 0.93 to 0.99 for flowers; r = 0.8842 to 1 for berries) with VvmiR160d (Fig. 8a and b). In general, the spatio-temporal expression and correlation analyses indicated that VvmiR160a/b/c were the key regulatory factors in grape floral and berry development through the negative regulation of VvARF expression.

The expression profiles of VvmiR160s and VvARFs in response to GA treatment during grape development

GA is an essential factor for plant growth and development and the exogenous application of GA induced the expression level of VvmiR160s in plants [19, 29]. However, the relative effect of GA-mediated grape flower and berry development through miR160s remains elusive. In the present study, a comparative expression level of VvmiR160s and VvARF target genes in GA-treated and untreated control (CK) plants during floral development was carried out (Fig. 9a). The exogenous application of GA significantly up-regulated VvmiR160a/b/c/e expression at 5DAT and 9DAT in comparison with untreated control plants (Fig. 9a). However, there was no significant effect of GA treatment on VvmiR160d expression (Fig. 9a). These results indicated that GA is a positive long-term regulator of VvmiR160a/b/c/e during grape floral development, and the various members of miR160 family possessed diverse modes of response to GA. On the other hand, GA treatment induced VvARF10/16/17 expression mainly at 2HAT (Fig. 9a), implying that these target genes displayed a short-term response to GA treatment during floral development. Unlike flower development, GA treatment almost significantly up-regulated the expression of VvmiR160s and three VvARFs genes at 45DAT (45 days after treatment; berry expansion) (Fig. 9b). In addition, the three VvARFs were slightly up-regulated at their expression levels by GA at the maturation stage (Fig. 9b).

Fig. 9
figure 9

Differential expression of VvmiR160 and VvARF target genes in response to GA application at different stages of floral and berry development. a Differential expression of VvmiR160s and their VvARF target genes in response to gibberellin (GA) treatment at different time points [0 h after treatment (0HAT), 2HAT, 1 day after treatment (1DAT), 5DAT, 9DAT] of floral development. b Differential expression of VvmiR160s and their VvARF target genes in response to gibberellin (GA) treatment at different time points (10DAT, 45DAT, 95DAT) of berry development. c Differential expression and Pearson correlation analysis of each member of VvmiR160 family and its respective VvARF target genes in response to GA treatment during floral development. d Differential expression and Pearson correlation analysis of each member of VvmiR160 family and its respective VvARF target genes in response to GA treatment during berry development. Each experiment was repeated three times. ANOVA test was used to identify significant differences, Asterisks indicate significant difference between GA-treated plants and respective untreated control (CK) plants at each time point as determined by Student’s t-test (*P < 0.05; **P < 0.01; ***P < 0.001)

Full size image

Further, we compared the expression levels of VvmiR160s and their VvARF target genes under GA treatments, we revealed that in grape flowers, VvmiR160a/c and VvARF10/16/17 expression exhibited some negative correlations (r = − 0.44 to − 0.53) in response to the short- and long-term effect of GA treatment in comparison with untreated controls (Fig. 9c); however, in berries, their expression did not possess the negative correlation (Fig. 9d). The correlation analysis indicated that GA might strength the regulatory roles of VvmiR160a/c on VvARF10/16/17 during floral development. However, VvmiR160b and its targets had negative correlations only in the short-term during floral development, while VvmiR160e and its targets possessed apparent negative correlations in the long-term. GA had no effect on VvmiR160d expression, compared with untreated control plants, and both VvmiR160d and VvmiR10/16/17 exhibited some positive correlation (r = 0.56 to 0.64) (Fig. 9c). In grape berries, VvmiR160a/b/c/d and VvARF10/16/17 expression exhibited some positive correlations (r = 0.69 to 0.99) in response to GA (Fig. 9d). These results suggested that VvmiR160a/b/c/d displayed various modes in responsive to GA during grape floral and berry development.

Considering the redundancy and complementary traits of miRNA’s function, the correlation analysis of the total expression levels of all members of VvmiR160 family and each of VvARF target genes was investigated (Fig. 10a and b). Results showed that the total expression of VvmiR160s had negative correlations with VvARF10/16/17 target genes mainly at the late stages (22DAI, 26DAI, and 30 DAI, marked with an asterisk) of grape floral development under control (Fig. 10a), and the total expression of VvmiR160s had negative correlations with VvARF10/16/17 target genes only at maturation (86DAA, marked with an asterisk) of grape berry development under control (Fig. 10a). While, under GA treatment, GA enhanced the negative regulatory effect of VvmiR160s on their target genes nearly at all stages (0HAT to 9DAT, marked with an asterisk) of grape floral development (Fig. 10b); however, no obvious effect of GA on the interaction of VvmiR160s and their target genes was observed during grape berry development (Fig. 10b). These results suggested that VvmiR160 family might possess some redundancy of functions, and indicated that GA is an essential factor for inducing the regulatory roles of VvmiR160s on their targets at short-term as well as long-term.

Fig. 10
figure 10

Pearson correlation analysis of total expression of VvmiR160s and their VvARF targets genes. a Correlation of total expression of VvmiR160s and their VvARF target genes during grape development [21 days after inflorescences (21DAI), 22DAI, 26DAI and 30DAI; 1 day after anthesis (1DAA), 36DAA, 86DAA]. b Correlation of total expression of VvmiR160s and their VvARF target gene s in response to gibberellin (GA) treatment at different time points [0 h after treatment (0HAT), 2HAT, 1 day after treatment (1DAT), 5DAT, 9DAT, 10DAT, 45DAT, 95DAT]. ANOVA test was used to identify significant differences, Asterisks indicated statistically significant differences at (*P < 0.05; **P < 0.01; ***P < 0.001) as determined by Student’s t-test

Full size image

Dynamic accumulation of cleavage products of ARF10/16/17 during GA-induced grape floral development

Detecting the accumulation of cleavage products of VvmiR160s and VvARFs during grape floral development could be helpful to determine the spatio-temporal variation of their cleavage roles. Our modified RLM-RACE and developed PPM-RACE protocols together with qRT-PCR were employed to monitor their 3′- and 5′-cleavage products under GA treatment. Results showed that GA treatment promoted greater accumulation of 3′- and 5′-cleavage products of VvARF10/16/17 in comparison with untreated control plants (Fig. 11). GA induced the highest accumulation of 3′- and 5′-cleavage products of VvARF10/16/17 at 5DAT. However, GA slightly induced 3′- and 5′-cleavage products at 2HAT, indicating that GA exhibited a profound long-term effect on VvmiR160s’ cleavage roles rather than a short-term one (Fig. 11). Although, the accumulation of 5′-cleavage products of VvARF10/16/17 was almost similar to 3′-cleavage products at various phases in GA-treated and untreated control plants (Fig. 11), the 3′-cleavage products were slightly higher, which might be due to the high stability of 3′-cleavage products compared with 5′-cleavage products as previously reported [30, 33, 34].

Fig. 11
figure 11

Accumulation patterns of 3′- and 5′-end cleavage products of miR160s cleaved VvARF10/16/17 target genes in gibberellin (GA)-treated and untreated control (CK) plants at different stages of grape floral development. VvARFs-5’represents the accumulation of 5′-end cleavage products of VvARFs mediated by VvmiR160s using real-time qPCR; VvARFs-3′ represents 3′-end cleavage products. Each experiment was repeated three times. [0 h after treatment (0HAT), 2HAT, 1 day after treatment (1DAT), 5DAT, 9DAT]. ANOVA test was used to identify significant differences, Asterisks indicated statistically significant differences at (*P < 0.05; **P < 0.01) as determined by Student’s t-test

Full size image

Discussion

The effects of exogenous GA application on the induction of flower development, seedless cultivars, berry enlargement and fruit ripening of grapevine have recently been reported [18, 20]. However, the molecular mechanisms by which GA-signaling mediates flower and fruit set initiation in grapevines are still not fully understood. In recent years, miRNAs have been identified as a critical regulatory factor of gene expression through indirect, or direct transcriptional and post-transcriptional gene silencing to modulate the activity of the gene network underlying various developmental and stress-responsive programs [3, 9, 14, 21]. Several miRNA families involved in the modulation of barley (Hordeum vulgare), Arabidopsis, cotton (Gossypium hirsutum) and tomato flower development have been identified and released in miRBase [10, 11, 24, 35,36,37]. For example, a recent study has reported that targeting of ARF10/16/17 by miR160 is indispensable for various aspects of AUX-mediated floral organ abscission as well as ovary patterning in tomato plant [24]. Similarly, a loss-of-function of Arabidopsis atmir160a plants changed the expression of ARF16/17 and displayed different phenotypes, including irregular flowers, reduced fertility, aberrant seeds and floral organs inside siliques [30], HMW RNAs have been added to the Poly(A) (Ambion, Austin, TX) and ligated to 5′ adapter (5′-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3′) using T4 RNA ligase (Invitrogen, Carlsbad, CA), respectively. Then Poly (A)-tailed HMW RNA and adapter-ligated HMW RNA were recovered by phenol/chloroform extraction followed by ethanol precipitation. Poly (A)-tailed HMW RNA and adapter-ligated HMW RNA were further reverse transcripted into cDNAs for PPM-RACE and RLM-RACE. The amplification products were gel purified, cloned, and sequenced, and at least eight independent clones were sequenced.

Distribution of VvmiR160s and target VvARF genes in the precursors/chromosomes

The precursors of VvmiR160s were downloaded from the plant miRBase 21.0 (http://www.mirbase.org/). Mfold online tool (http://unafold.rna.albany.edu/) were applied to fold their hairpin structures. All five VvmiR160s and three VvARF genes were mapped to grapevine chromosomes based on information available at the Grape Genome CRIBI website (http://genomes.cribi.unipd.it/grape/). The map was drafted using MapInspect software (http://www.plantbreeding.wur.nl/uk/software- mapinspect.html).

Phylogenetic analysis

The software MEGA version 7.0.21 and ClustalX2 were employed to conduct the phylogenetic analysis. Homologs of VvARF10, VvARF16, VvARF17 were identified by a blast search in the NCBI databases (https://blast.ncbi.nlm.nih.gov/Blast.cgi) using amino acid sequences of VvARF10/16/17. Multiple alignmentswere performed using ClustalX2, and the unrooted phylogenetic trees were constructed with MEGA 7.0.21 software using the Neighbor-Joining method, and the bootstrap test was carried out with 1000 replications.

Analysis and distribution of exon/intron structures of ARFs in nine species

The exon/intron organization of VvARF genes was determined by comparing predicted coding sequences with their corresponding genomic sequences using the GSDS software (http://gsds.cbi.pku.edu.cn).

Protein domains and their physicochemical properties analysis of target ARFs in various species

The Domains & Structures website (https://www.ncbi.nlm.nih.gov/guide/domains- structures/) were used to analyze protein domains of target genes, and their homologs sequences. Then, the IBS (Illustrator for Biological Sequences) software version 1.0.3 was used to draw the orthodox domains of ARF proteins. Besides, all target ARF protein sequences were considered and used in further analysis. Number of amino acids, isoelectric point, aliphatic index, grand average of hydropathicity, the molecular weight of deduced polypeptides were calculated by using tools provided at the ExPasy website (http://web.expasy.org/protparam/).

Motif composition analysis of ARF proteins in nine species

The identification of motifs in the ARF protein sequences was performed with the MEME 5.05 online program (http://meme-suite.org/tools/meme). The optimized parameters of MEME were employed as follows: number of repetitions, any; maximum number of motifs, 20; and the optimum width of each motif, between 6 and 50 residues.

Cis-element analysis of the promoters from VvMIR160s and target VvARFs

From the grape genoscope database (http://www.genoscope.cns.fr/externe/GenomeBrowser/Vitis/), we obtained the promoters (approximately 1500 bp upstream of genes) of VvMIR160 (VvmiR160’s precursors) and VvARFs, and employ the Plantcare software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) to predict the motif elements in these promoters.

Construction of the expression vector and Agrobacterium-mediated tobacco transient transformation

The promoter sequences of VvMIR160c and VvARF10 were isolated. The primers used were described in Additional file 6: Table S4. To develop pBI121-p1VvMIR160c-GUS and pBI121-p1VvARF10-GUS constructs, 1.5 kb promoter regions of VvMIR160c and VvARF10 were independently cloned and fused with GUS reporter gene to replace the 35SCaMV promoter in pBI121 binary vector. With respect to pBI121-p2VvMIR160c -GUS construct, 1442 bp promoter 2 fragment region of VvMIR160c without including the GA response element (59–1500 bp) was cloned into pBI121 to replace the 35SCaMV promoter and was used to drive the GUS reporter gene. Similarly, for pBI121-p2VvARF10-GUS construct, 937 bp promoter 2 fragment region of VvmiR160c without GA response element (564–1500 bp) was cloned into pBI121 to replace the 35SCaMV promoter and was used to drive the GUS reporter gene.

A single colony of Agrobacterium tumefaciens EHA105 (containing the recombinant plasmid) was cultured in YEB liquid medium supplied with rifampin (50 μg mL− 1) and kanamycin (50 μg mL− 1). After culturing, the bacteria were pelleted and resuspended in suspension buffer (10 mM MES, 10 mM MgCl2, pH 5.6). The bacterial.

suspension was then adjusted to OD600 = 0.5, and 100 μmol L− 1 acetosyringone was added before the suspension was used for infiltration, and left to stand at room temperature for 4 h. The leaves of 6-week-old tobacco plants were infiltrated with the bacterial suspension by injection. Tiny holes were made in the tobacco leaves using syringe needles. The bacterial suspension was then injected into those tiny holes with a needleless syringe. The infiltrated seedlings were then moved back to the environmental chamber and kept in the dark for 3 d. Treatment on tobacco leaves with 30 μM GA and 50 μM GA were performed 2 days later. The uniformly sized leaves were used in infiltration experiment, and the experiment was repeated three times.

GUS assay

The infiltrated leaves were punched and then histochemical GUS staining of infiltrated leaves was performed as described by Jia et al. [54]. Leaves were then immersed in ethanol to remove Chl. Quantification of GUS activity was determined using the fluorometric 4-methylumbelliferyl-b-D-glucuronide (MUG) method. One unit of GUS activity was defined as 1 nM of 4-methylumbelliferon (4-MU) generated per minute per milligram of soluble protein. Three leaves were infiltrated for each construct in each independent experiment, and then combined to detect GUS activity.

Expression analysis of VvmiR160s by qRT-PCR

The template for quantitative real-time polymerase chain reaction (qRT-PCR) was the cDNA for poly(A)-tailed small RNA mentioned above. To amplify the VvmiR160a/b/ c/d/e from the reverse-transcribed cDNAs, we used the precise sequences of VvmiR160 family members as the forward primer and R16328 (ATTCTAGAGGCCGAGGCGGCCGACATG) as the reverse primer [30]. qRT-PCR was performed with SYBR Premix Ex Tap™ kit (TaKaRa, Dalian, China), using Light Cycler®480 II (Roche, Switzerland). PCR cycling conditions consisted of an initial denaturation step at 95 °C for 30s, followed by 40 cycles at 60 °C for 20s and 95 °C for 5 s. The 5.8 s rRNA was used as a reference gene. Relative expression level was calculated with the formula 2−ΔΔCT = normalized expression ratio. Each PCR assay was carried out by three biological replicates, and each replicate corresponded to three repeats of separate experiments. All primers were listed in Additional file 6: Table S4.

Real-time PCR of the VvARFs expression

The expression of VvARF10/16/17 was assayed by qRT-PCR as previously described [30]. The reverse transcription product was amplified using gene-specific primers that overlapped the known or predicted cleavage site. Reactions were performed in triplicates using the Light Cycler®480 II. The Actin gene was used as a reference gene in the qRT-PCR detection of mRNAs. Relative expression level was calculated with the formula 2−ΔΔCT = normalized expression ratio. Each PCR assay was carried out in three biological replicates. The experiments were set the three repeats. All primers were listed in Additional file 6: Table S4.

Statistics

ANOVA test was used to identify significant differences in floral morphology and gene expression between GA3-treated and untreated grape plants. Asterisks indicate a significant difference between GA-treated plants and respective untreated control (CK) plants at each time point as determined by Student’s t-test (*P < 0.05; **P < 0.01).