Introduction

Human immunodeficiency virus type 1 (HIV-1) is an incurable infection that causes acquired immune deficiency syndrome (AIDS). Antiretroviral therapy (ART) suppresses HIV-1 to undetectable levels and partially restores immune function in infected individuals. However, interrupting ART causes the virus to rapidly rebound to pretreatment levels1,2. The main cause of treatment failure is due to the existence of latent HIV-1 reservoirs. Resting CD4+ T cells harboring integrated and transcriptionally silent proviruses are the best-characterized reservoir, can evade host immune surveillance and resume production of infectious viral particles once the therapy is interrupted3,4,5. This latent reservoir, likely established within days of infection6, persists throughout life due to its extreme stability, makes life-long ART necessary and represents the primary hurdle to an HIV-1 cure7.

Understanding the molecular mechanisms of HIV-1 latency is a prerequisite for designing new treatments that aim to eliminate the reservoirs. Much progress has recently been made to elucidate the molecular mechanisms underlying HIV-1 proviral latency8,9,10, mostly acting at the level of transcriptional suppression of the viral promoter long terminal repeats (LTR). Transcriptional blocks to productive HIV-1 replication include epigenetic modifications at the HIV-1 LTR11,12, the presence of transcriptional repressors and inadequate availability of activation-dependent transcription factors, such as human positive transcription elongation factor b (P-TEFb), an essential co-factor for Tat, etc13,14.

Several therapeutic strategies have been proposed to eliminate or control the pool of latent HIV-1. These involve either complete elimination of all persistent HIV-1, called sterilizing cure, or immunological control of persistent HIV-1, called functional cure15. The “shock and kill” strategy has gained much attention as a basis for sterilizing cure16 and finding efficient small molecule latency reversing agents (LRAs) to induce virus production without causing global T cell activation has been a research priority in the HIV-1 field in recent years17,18. To this end, several small molecules have been shown to stimulate HIV-1 transcription in latently infected cells18. However, these compounds are toxic, mutagenic or ineffective in trials involving enlarged sample size and prolonged treatment10,19,20,21,22. Thus, more effective and specific latency activators are urgently needed.

Recently, the therapeutic potential of pharmacologic inhibition of members of the bromodomain and extraterminal domain (BET) family has received much attention. The BET protein family is a well-conserved class of transcriptional regulators that are distinguished by the presence of tandem bromodomains, conserved domains and an extraterminal domain23,24. It is thought that targeting the binding of BET proteins to chromatin may provide an effective way to regulate HIV-1 gene expression and in particular, transcription elongation25,26. Notably, a number of studies have reported that the BET inhibitor JQ1 can reactivate HIV-1 in different latency models and also in ART treated patients when combined with an HDACi or PKC agonist25,27,Fig. 9). These results indicate that OTX015 activates latent HIV-1 through increasing P-TEFb recruitment to the LTR and then inducing RNAP II CTD phosphorylation and viral transcription.

Figure 9
figure 9

OTX015 increases CDK9 recruitment to the HIV-1 LTR and induces RNAP II CTD phosphorylation.

(A) C11 cells were mock-treated or stimulated with OTX015 (0.5 μM) for 6 h. ChIP assays were performed using antibodies against CDK9, Pol II CTD-Ser2P or normal mouse IgG. PCR primers specific for the LTR promoter were used to amplify the DNA isolated from the immunoprecipitated chromatin as described in Materials and methods. (B) Each ChIP experiment was repeated three times to confirm reproducibility of the results. Real-time quantitation of the fold change relative to the DMSO control is shown. **p < 0.01.

Full size image

In addition, these findings provide some evidence that the combination of OTX015 and prostratin synergistically activated HIV-1 LTR-driven GFP expression in C11 cells (Fig. 2). This activation is likely due to their cooperative activation of different stages of the HIV-1 transcription cycle—prostratin is known to activate NF-κB and ELL2, which in turn promote RNAP II recruitment and entry into the pause site, thus working on transcription initiation25,56,57, whereas OTX015 acts subsequently to enhance Pol II elongation.

Discussion

Latent reservoirs of HIV-1 are the main barrier to the eradication of infection. The “shock and kill” strategy is the main focus of current research efforts. In this strategy, LRAs would be used to induce the reactivation of latent HIV-1 in the presence of ART. After reactivation, latent HIV-1 expression would induce viral cytopathic effects, immune clearance and cell death, thereby purging latently infected cells while uninfected cells are protected by ART15,16. The first challenge to this strategy is to find ways to efficiently reactivate latent HIV-1. A number of agents have been explored14,55. To overcome this restriction, the viral protein Tat interacts directly with TAR and recruits P-TEFb, which is composed of CDK9 and Cyclin T1 domains, to the HIV-1 LTR. Enzymatically active CDK9, which requires phosphorylation of Thr186 in its T-loop, phosphorylates the CTD of RNAP II and the negative elongation factors, thereby increasing the rate of HIV-1 transcription13. The BET proteins also obstruct HIV-1 gene expression in this signaling pathway. For example, BRD4 has been shown to compete with Tat for P-TEFb binding, inhibiting the activation of transcription elongation25. BRD2 also acts as an endogenous negative regulator of HIV-1 latency30. Therefore, BET inhibitors can indirectly lead to transcriptional effects by altering the available cellular pool of P-TEFb and may provide a novel therapeutic approach to reverse HIV-1 latency64,65.

In the current study, we evaluated the anti-latency ability of a novel oral BET inhibitor OTX015. Our data showed that OTX015 can effectively reactivate HIV-1 in different Jurkat cells-based latency models and, notably, its EC50 value was 1.95–4.34 times lower than JQ1. However, while the EC50 value was similar in both cell lines, the magnitude of latency reversal was significantly different; a maximum GFP positive population of 90% was achieved with C11 cells, but a maximum of 36% of A10.6 cells became GFP positive. This is possibly because that the pseudovirus used in establishment in vitro HIV-1 latency model are different. The genome of J-Lat A10.6 clone does not contain the integration of a complete HIV-1 genome but the vector pEV731 that is a minimum transcription-competent HIV-1 provirus expressing the viral Tat protein together with GFP upon LTR promoter activation35. The genome of C11 clone contain the vector pNL4-3 that is a HIV-1 constructor imported EGFP-encoding gene in a nef open reading frame mutated into Env and Vpr genes34. Besides, the HIV-1 integration sites in different latently infected cells are also different and it influences the virus transcription9. As mentioned above, we need to specify that these data came from in vitro studies in cell lines latently expressing defective provirus with potentially complete ability to initiate replication. Further investigations to confirm this using primary latency model are warranted.

Combination therapy can reduce the chance of evolving drug resistance, decrease side effects and achieve enhanced potency66. As such, we also examined whether OTX015 could synergize with other activators. Our results showed that its effect is potently enhanced in combination with prostratin. Moreover, they do not induce global T cell activation as prostratin treatment alone. Also this provided several clues for exploring the mechanism of OTX015 in reversing HIV-1 latency. Further experiments are needed to explore the correlation between OTX015 and other types of activators.

Remarkably in our study, we found OTX015 treatment alone could induce latent HIV-1 full-length transcripts and viral production in resting CD4+ T cells from infected individuals on suppressive ART. Importantly, unlike other LRAs, such as PHA, PMA and prostratin, which effectively reverse HIV-1 latency ex vivo but induce global T cell activation67 and are too toxic for clinical use, OTX015 exerted no effects on T cell activation and its CC50 was much higher than its EC50. But importantly to point out that the increases in viral outgrowth induced by OTX015 were very modest, we need to optimize the concentration and timepoint of OTX015, as well as its combination treatment with other activators, in resting CD4+ T cells from HIV-1 infected patients to further improve its efficacy in inducing HIV-1 expression in the future. Nevertheless, these existing data support further investigation of OTX015 as a potential candidate in HIV-1 cure studies.

It has often been debated whether or not the effect of BET inhibitors on latent HIV-1 depends on Tat. Zhu et al. reported modest stimulation of an HIV-LTR reporter by JQ1 in the absence of Tat. However, a combination of JQ1 and Tat resulted in more cells with reactivated viruses29. Li et al. showed that the effect of JQ1 in activating latent HIV-1 is Tat-dependent in Jurkat 1G5 and HeLa-based NH1 and NH2 cells25. On the other hand, Boehm et al. showed that this activation is P-TEFb dependent, but independent from the viral Tat protein30. Our studies performed in Hela-based TZMbl cells and primary CD4+ T cells isolated from healthy donors demonstrate that Tat plays a critical role in OTX015-mediated activation of latent HIV-1.

Levels of active P-TEFb are pivotal in promoting the switch to productive elongation and therefore play a large role in controlling the expression of viral genes68. Our data show that OTX015-mediated activation of HIV-1 involved an increase in CDK9 T-loop phosphorylation, which is required for the catalytic activity of CDK9. Through ChIP assays, we further found that OTX015 stimulation promoted CDK9 recruitment directly to the HIV-1 LTR and induced RNAP II CTD phosphorylation and viral transcription. As BET proteins are similar in structure69, it is unclear which target is closely related to OTX015-mediated reversal of HIV-1 latency. However, our studies yield important mechanistic insights into the mechanism of action of BET inhibitors.

In summary, we have provided strong evidence that the BET inhibitor OTX is a potent antagonist of HIV-1 latency and acts by increasing the occupancy of CDK9 at the HIV-1 LTR and inducing RNAP II CTD phosphorylation. We also demonstrated the important role of the viral protein Tat in regulating OTX-mediated HIV-1 LTR gene expression. However, it is important to extend these observations to a wider population of latent cells from infected individuals undergoing ART to confirm the potential of OTX015 as a drug candidate in anti-HIV-1-latency therapy.

Methods

Cell culture

Jurkat C11 cells34 (constructed in our lab) or A10.6 cells35,70 (obtained from NIH AIDS Reagent Program) were cultured in RPMI1640 medium with 10% fetal bovine serum (FBS) and 1% Pen/strep in a 37 °C incubator containing 5% CO2. Reactivation of HIV-1 LTR was performed by treating cells with OTX015 (Selleckchem), JQ1 (Selleckchem) or prostratin (Sigma). HIV-1 reactivation was quantified by GFP expression using flow cytometry (Caliber, BD) and analyzed using FlowJo Software.

Quantitative analysis of latency-reversing agent combinations

We used the Bliss independence model as a metric to evaluate the latency-reversing activity of drug combinations36. This model is defined by the equation

where faxy,P is the predicted fraction affected by a combination of drug x and drug y, given the experimentally observed fraction affected by treatment with drug x (fax) or drug y (fay) individually. The experimentally observed fraction affected by a combination of drug x and drug y (faxy,O) can be compared with the predicted fraction affected, which is computed using the Bliss model (faxy,P) as follows:

If Δfaxy > 0 with statistical significance, then the combined effect of the two drugs exceeds that predicted by the Bliss model and the drug combination displays synergy. If Δfaxy = 0, then the drug combination follows the Bliss model for independent action. If Δfaxy < 0 with statistical significance, then the combined effect of the two drugs is less than that predicted by the Bliss model and the drug combination displays antagonism. In our analysis, the fraction affected was calculated as follows for the percentage of GFP-positive cells: fax = % GFP-positive cells after treatment with drug x–% GFP-positive cells treated with the DMSO control.

Isolation of resting CD4+ T cells

Shanghai Public Health Clinical Center approved this study and the methods were carried out in accordance with the guidelines of Bullen, C. K. et al.37. All research participants in this study gave written informed consent. HIV-1-infected individuals were enrolled under the criteria of suppression of viremia to undetectable levels (<50 copies/ml) on ART for at least six months. Peripheral blood mononuclear cells (PBMCs) were purified using density gradient centrifugation from whole blood. CD4+ T lymphocytes were enriched by negative depletion (CD4+ T cell Isolation Kit, Miltenyi Biotec). Resting CD4+ T lymphocytes were further enriched by depletion of CD69+, CD25+ or human leukocyte antigen DR+ (HLA-DR+) cells. The purity of the isolated resting CD4+ lymphocytes was verified by flow cytometry and was typically greater than 95%.

Measurement of intracellular HIV-1 RNA transcripts

Purified resting CD4+ T cells (5 × 106) were treated with SAHA or OTX015 for 18 h in the presence of 10 μM T20 and collected for RNA purification. Total RNA was extracted using the ZR-96 Viral RNA Kit (Zymo Research). cDNA synthesis was performed using the GoScript Reverse Transcription System containing an oligo(dT)15 primer (Promega). Real-time PCR was performed in triplicate using the QuantiFast SYBR Green PCR Kit (QIAGEN) on a Roche LightCycler 480 II machine. Primers and probes specific for the HIV-1 3′ polyadenylation (poly A) region were designed as described37,71: forward (5′-3′) CAGATGCTGCATATAAGCAGCTG (9501–9523), reverse (5′-3′) TTTTTTTTTTTTTTTTTTTTTTTTGAAGCAC (9629-poly A) and probe (5′-3′) FAM-CCTGTACTGGGTCTCTCTGG-MGB (9531–9550). Results from the triplicate samples for each drug treatment were averaged and presented as fold change relative to DMSO control.

MOLT-4/CCR5 outgrowth assay

Purified resting CD4+ T cells (5 × 106) were treated with PMA plus ionomycin or OTX015 for 18 h and washed with 1 ml sterile PBS to remove residual drug. Resting CD4+ T cells were then cultured with MOLT-4/CCR5 cells in 8 ml RPMI1640 medium plus 10% FBS in individual wells in six-well culture plates. After four days and seven days of culture, wells were resuspended and split 1:2 with the medium volume adjusted to 8 ml per well. After 14 days of culture, viral outgrowth was assessed using the HIV-1 p24 Antigen ELISA kit (ZeptoMetrix)37.

Measurement of cell viability and detection of T cell activation markers and HIV-1 receptors/co-receptors

PBMCs from healthy individuals were placed in 96-well plates and incubated with OTX015 for 48 h. Cell viability was measured using the Cell Counting Kit-8 (Do**do Molecular Technologies) as described72. To measure changes in the cell activation status and presence of HIV-1 receptors/co-receptors, CD4+ lymphocytes isolated from healthy donors were incubated with prostratin, OTX015 or OTX015/prostratin for 48 h and immunostained with anti-CD25, anti-CD69, anti-HLA-DR, anti-CD4, anti-CCR5 or anti-CXCR4 antibodies (BD-Biosciences) for 20 min at 4 °C. Cells were fixed in 1% PFA and analyzed by flow cytometry.

Transient transfection and luciferase assays

TZMbl cells73, grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS, were plated at 1 × 105 cells/well in 24-well culture plates 24 h before transfection and then transfected with Tat or pcDNA 3.1 plasmid using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions. Primary CD4+ T cells (5 × 106) isolated from healthy donors were transfected with Tat or pcDNA 3.1 plasmid at the presence of LTR-Luc construct using Amaxa® Human T Cell Nucleofector® Kit (Lonza) following the manufacturer’s instructions and then plated in 6-well culture plates. At 24 h post-transfection, the cells were mock-treated or treated with OTX015. At 48 h post-treatment, cells were lysed and luciferase activity was measured using the Dual-Luciferase Reporter Assay Kit (Promega).

Western Blotting

Western blot analysis was performed as described74. C11 cells were treated with OTX015 or JQ1 for 24 h and lysed on ice for 30 min. Approximately 50–150 mg of thermally denatured protein extract was loaded on a 10% polyacrylamide gel, electroblotted onto a nitrocellulose membrane and blocked for one hour. The membrane was then incubated with CDK9, Cyclin T1 or CDK9-pT186 antibodies (Cell Signaling Technology). Bands were visualized using the ECL Western blotting system (Santa Cruz Biotechnology).

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed according to the manufacturer’s protocol (Millipore) and previously described procedures72,75. Briefly, C11 cells (1 × 107) were treated with OTX015 for six hours, fixed in 1% formaldehyde, resuspended in lysis buffer and sonicated to obtain DNA fragments of 500–1000 bp. DNA fragments were incubated with IgG, CDK9 or Pol II CTD-Ser2P (Abcam) antibodies at 4 °C overnight and immune complexes were retrieved by incubating with Protein G agarose beads. Following washing, the chromatin was eluted and reverse cross-linked overnight. DNA was extracted and quantitative real-time PCR was performed using the SuperReal PreMix Plus (TIANGEN) on a Roche LightCycler 480 II machine with the forward (5′-AGACTGCTGACATCGAGCTTTCT-3′) and reverse primer (5′-GTGGGTTCCCTAGTTAGCCAGAG-3′). Results from fragments obtained after incubation with different antibodies were normalized against input DNA and presented as fold change relative to DMSO control.

Statistical analysis

Means and standard errors (SE) were calculated for all data points from at least 3 independent experiments in triplicates. Statistical significance was determined using the two-way Student t test, where p value < 0.05 considered significant.

Additional Information

How to cite this article: Lu, P. et al. The BET inhibitor OTX015 reactivates latent HIV-1 through P-TEFb. Sci. Rep. 6, 24100; doi: 10.1038/srep24100 (2016).