Abstract
Activation of axonal growth program is a critical step in successful optic nerve regeneration following injury. Yet the molecular mechanisms that orchestrate this developmental transition are not fully understood. Here we identified a novel regulator, insulin-like growth factor binding protein-like 1 (IGFBPL1), for the growth of retinal ganglion cell (RGC) axons. Expression of IGFBPL1 correlates with RGC axon growth in development, and acute knockdown of IGFBPL1 with shRNA or IGFBPL1 knockout in vivo impaired RGC axon growth. In contrast, administration of IGFBPL1 promoted axon growth. Moreover, IGFBPL1 bound to insulin-like growth factor 1 (IGF-1) and subsequently induced calcium signaling and mammalian target of rapamycin (mTOR) phosphorylation to stimulate axon elongation. Blockage of IGF-1 signaling abolished IGFBPL1-mediated axon growth, and vice versa, IGF-1 required the presence of IGFBPL1 to promote RGC axon growth. These data reveal a novel element in the control of RGC axon growth and suggest an unknown signaling loop in the regulation of the pleiotropic functions of IGF-1. They suggest new therapeutic target for promoting optic nerve and axon regeneration and repair of the central nervous system.
Similar content being viewed by others
Introduction
The exuberant growth of axons in the mammalian central nervous system (CNS) becomes markedly reduced as neurons mature. This is in part a result of the developmental shutdown of the axon growth program which contributes critically to the failure of CNS regeneration and repair after injury1,2,3,4. Retinal ganglion cells (RGCs), which have long served as a standard model of CNS neurons, switch off the intrinsic axon growth program during the prenatal period in mice5,6,7. Upon differentiation, develo** RGCs must receive accurate and timely stimulation to initiate the intrinsic axon growth program for successful development of the optic nerve. One potential mechanism is governed through secretory factors that, when bound to neurons, switch on intracellular axon growth cascades, while their absence turns off the axon growth signals and leads to loss of nerve regenerative capacity. These factors may represent important targets for therapeutic interventions to promote regeneration after CNS injury. To date, the molecular signals that orchestrate the transition of RGC axon growth cascades have not been fully understood.
Studies have suggested that IGF-1 (insulin-like growth factor-1) is required for the growth of CNS axons. The question remains as how IGF-1 activates the axon growth machinery in the develo**, but not adult, neurons of the CNS. Intriguingly, IGF-1 mediates not only axon growth, but multiple other biological processes of develo** neurons, including proliferation, survival, and synaptogenesis. To date, at least 7 IGF binding proteins (IGFBPs) and an IGFBP like protein 1 (IGFBPL1) are identified. We hypothesized that IGF-1 requires IGFBP, which may be expressed during certain period in development, to selectively enable the activation of IGF-1-induced pleiotropic signaling cascades. In the present study, we showed that IGFBPL1 is a critical co-factor of IGF-1 for its activation of axon growth cascades. Acute knockdown of IGFBPL1 with shRNA nullifies IGF-1-induced axon growth activities in develo** RGCs. In contrast, administration of IGFBPL1 stimulated RGC axon elongation. IGFBPL1 activates the axonal growth machinery by binding with IGF-1 to enable intracellular Ca2+ elevation essential for axon extension. Finding of the function of IGFBPL1 in IGF-1-mediated axon growth function unveils a new regulatory element in its pleiotropic activities. IGFBPL1, as a secretory factor that directly regulates axonal growth, may present a possibility for pharmacological manipulation to promote axon regeneration and reverse vision loss after injury in human patients.
Results
Developmental loss of IGFBPL1 expression correlates with the cessation of RGC axon growth
Mouse RGC axons switch off exuberant growth between embryonic day 16 (E16) and birth (P0)6,8 presents a unique tractable model for identification of candidate regulators of axonal growth by comparing gene expression profiles. Through analysis of cDNA microarray data obtained from E16 and P0 retinas, a novel secretory protein IGFBPL1 emerged as a candidate molecule whose levels of expression correlated with RGC axon growth capacity. This result was confirmed by quantitative RT-PCR (qPCR) that examined RNA levels in the retinas of E16, P0, and adult mice (Fig. 1A). β-III-tubulin, as shown by our lab and others, is a marker of RGCs in the GCL of the mouse retina9,10. Double-immunolabeling of IGFBPL1 and a primary antibody against β-III-tubulin (Tuj1; Fig. 1B and Supplementary Fig. 1) revealed that IGFBPL1 was highly enriched in the ganglion cell layer (GCL) of E16 retinas. Its expression dropped sharply at P0 and became non-detectable after P10 to adulthood (Fig. 1A,B). During development, exuberant growth of RGC axons is largely reduced by P0, while a sub-cohort of late-born RGCs is reported to continue extending axons up to P6-711,12,13. The spatiotemporal expression of IGFBPL1 thus correlates precisely with the growth status of RGC axons, raising the possibility that IGFBPL1 participates in the regulation of RGC axonal growth.
IGFBPL1 mediates RGC axon growth in vitro
To explore the role of IGFBPL1 in RGC axonal growth, we utilized shRNA silencing to acutely knockdown the expression of IGFBPL1 in a standard model of purified RGC cultures. Primary RGCs isolated from newborn (P0) mouse pups were infected with lentiviral particles carrying IGFBPL1 shRNA or scrambled shRNA tagged with green fluorescence protein (GFP). After 3 days of incubation, RGCs infected by IGFBPL1 shRNA, but not scrambled shRNA, exhibited a complete knockdown of IGFBPL1 mRNA and protein expression as revealed by qPCR and Western blot (Fig. 2A–C and Supplementary Fig. 2); the expression of other genes, e.g. IGF-1 and p53, was not affected. Accompanied with the knockdown of IGFBPL1, we noted an over 30-fold reduction in average axon length (Fig. 2D) and a 7-fold reduction in the number of RGCs bearing axons (Fig. 2E), but only a moderate reduction (~30%) of RGC survival, compared to cultures treated with scrambled shRNA (Fig. 2F). Notably, surviving RGCs in IGFBPL1 shRNA treated cultures did not grow neurites, indicating their impaired ability to grow axons. To test if IGFBPL1 can stimulate RGC axon outgrowth in culture, recombinant mouse IGFBPL1 protein was added to the cultured RGCs purified from P0 mouse pups (Fig. 2G). After 3 days of incubation, addition of IGFBPL1 significantly enhanced RGC axonal outgrowth (Fig. 2H,I). At the optimal concentration (400 ng/ml), administration of IGFBPL1 induced a 3-fold increase in axon length and 2-fold increase in the number of RGCs bearing axons; whereas, addition of IGFBPL1 did not significantly increase RGC survival (Fig. 2I). Thus, IGFBPL1 regulates RGC axonal growth without significantly affecting cell survival.
To determine if the axon growth promoting effect of IGFBPL1 is limited to RGCs, we knocked down IGFBPL1 in PC12 cells and mouse hippocampus neurons. Consistently, we observed reduced neurite length without significant change in cell survival in both PC12 (Supplementary Fig. 3A,B) and hippocampal neuron cultures (Supplementary Fig. 3C,D). Addition of IGFBPL1, in contrast, led to significantly increased neurite outgrowth in PC12 cell (Supplementary Fig. 4A,B) and hippocampal neuron cultures (Supplementary Fig. 4C,D). Together, these data indicate that IGFBPL1 is generally involved in the regulation of neuron axon growth.
IGFBPL1 deficiency impaired RGC axon growth in vivo
To investigate if IGFBPL1 is required for RGC axonal growth in vivo during development, we generated Igfbpl1 null mutant (Igfbpl1−/−) mice. Quantification with qPCR confirmed the absence of IGFBPL1 mRNA in homozygous knockout (Igfbpl1−/−) mice (Fig. 3A). Igfbpl1−/− mice were viable and fertile without apparent growth defects or phenotypes. The retinas of newborn Igfbpl1+/− and Igfbpl1−/− mice displayed normal laminar structure, and immunohistochemistry. Results of qPCR that examined the expression of various retinal cell markers revealed no significant defects associated with photoreceptor and interneuron gene expression (not shown). In agreement with the specific localization of IGFBPL1 in RGCs, new born Igfbpl1−/− mice exhibited a largely reduced number of axons (~40%) in the optic nerve compared to wild-type (WT) littermates (Fig. 3B,C), while they showed approximately 20% reduction in number of RGCs as compared to the WT littermates (Fig. 3D,E).
To verify that impaired axon growth in Igfbpl1−/− mice is a direct consequence of IGFBPL1 deficiency, we isolated RGCs from newborn (P0) Igfbpl1+/− and Igfbpl1−/− mice. RGCs taken from P0 Igfbpl1+/− and Igfbpl1−/− mouse pups exhibited a 50% reduction in axon length in culture compared to WT littermates (Fig. 3F,G); whereas, the survival of RGCs of Igfbpl1−/− mice was reduced by only ~15% compared to WT mice (Fig. 3H). Addition of IGFBPL1 protein to RGCs of Igfbpl1−/− mice in culture completely rescued the axonal growth and survival defects (Fig. 3G,H), suggesting that these growth defects were a result of IGFBPL1 deficiency rather than developmental defects of other cellular cascades. The data supports that IGFBPL1 plays an important role in mediating RGC axon growth during development in vivo. The relatively milder impact of gene deletion of IGFBPL1 on RGC axon growth than the acute knockdown of IGFBPL1 with shRNA suggests possible functional redundancy among IGFBPs.
IGFBPL1 regulates axon growth through binding to IGF-1
Because IGFBPL1 shares an IGF-1 binding domain with all IGFBPs, we asked if IGFBPL1 binds IGF-1 in axon growth regulation. We examined the direct physical interaction of IGFBPL1 and IGF-1 using purified recombinant proteins. Bacterially produced IGF-1 was co-immunoprecipitated (co-IPed) with recombinant IGFBPL1, which was purified from a mouse myeloma cell line. Notably, recombinant IGF-1 bound to IGFBPL1 ex vivo (Fig. 4A), suggesting that IGF-1 can directly bind with IGFBPL1. To test if IGFBPL1 directly interacts with IGF-1 in vivo under physiological conditions, retinal lysates of newborn mice were co-IPed using IGFBPL1 or IGF-1 antibodies. IGFBPL1 was precipitated from the retinal lysates with an anti-IGF-1 antibody, and reciprocally, IGF-1 was detected in the co-IPed product pulled down by anti-IGFBPL1 antibody (Fig. 4B). These results indicate the physical interactions of IGFBPL1 and IGF-1 in vivo at the physiologically relevant protein levels.
We proposed that the interaction between IGF-1 and IGFBPL1 enables RGC axonal growth signaling. To test this, NBI-31772 (NBI), a non-peptide ligand that displaces IGF-1 from all currently known IGF-1 binding proteins5A,B). This pattern of IGF-1 expression parallels that of IGF-1R in the retina (Fig. 5C) and is in agreement with the reported expression profile of IGF-115. Thus, IGF-1, IGF-1R and IGFBPL1 are concurrently expressed in the perinatal retina when RGCs exuberantly grow axons. Down-regulation of IGFBPL1, and to a less extent for IGF-1 or IGF-1R, correlates with the cessation of RGC axon elongation in development.
To further investigate if IGFBPL1 functions conjointly with IGF-1 to induce axonal growth, we examined RGCs isolated from P10 (rather than P0) mouse pups, when the retina produces minimal amounts of endogenous IGF-1 (Fig. 5A,B) and IGFBPL1 (Fig. 1B). As expected, P10 RGCs exhibited minimal axonal growth when was treated with a vehicle control. Addition of IGF-1 or IGFBPL1 alone, at increasing doses up to 750 ng/ml, to P10 RGC cultures did not significantly promote axon growth when compared with the control group (Fig. 6A–E). In contrast, co-administration of IGF-1 and IGFBPL1, even at low concentrations (e.g., 75 ng/ml), induced significant axon growth through increased axon length and numbers without improvement of cell survival (Fig. 6A–E). This result strongly supports that IGFBPL1 is a co-factor of IGF-1 for activating the axon growth signaling.
IGFBPL1 enables IGF-1-induced Ca2+ signaling to promote axonal growth
Elevation of intracellular calcium ([Ca2+]i) is an essential component of the signaling cascades required for the initiation of RGC axon growth8. We next examined the changes of [Ca2+]i induced by IGFBPL1 and/or IGF-1 in P10 RGC cultures. Treatment with either IGFBPL1 or IGF-1 alone did not induce significant changes in [Ca2+]i when compared to vehicle treated cultures (Fig. 6F,G), corresponding to their inability to stimulate axonal growth in P10 RGCs. In contrast, co-application of IGFBPL1 and IGF-1 induced robust elevation of [Ca2+]i over the control group (Fig. 6F,G). To determine if this elevation of [Ca2+]i was responsible for the axon growth-promoting activities, we blocked [Ca2+]i change with Ca2+ chelators, EGTA (ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid)16,17 or L-type Ca2+ channel antagonist Nifedipine18,19. Administration of EGTA or Nifedipine blocked the axon growth-promoting effects induced by co-application of IGFBPL1 and IGF-1 (Fig. 7A,C) without affecting cell survival (Fig. 7B). In contrast, administration of Ca2+ channel agonist FPL64176 (FPL)—a potent L-type Ca2+ channel activator20,21—to P10 RGC cultures stimulated robust axonal outgrowth similar to what was seen in cultures receiving IGFBPL1 and IGF-1 co-treatment (Fig. 7D–F). FPL induced a larger than 2-fold increase in axon length over that of the control group. Moreover, addition of FPL to RGC cultures receiving IGFBPL1 and IGF-1 co-treatment did not further enhance their axon growth activity (Fig. 7D), suggesting that IGF/IGFBPL1 and FPL work through a common mechanism. Thus, the presence of IGFBPL1 enables IGF-1 to activate [Ca2+]i signaling and the intracellular events that lead to axonal growth.
As Phosphoinositide 3-kinase/mammalian target of rapamycin (PI3K/mTOR) are indicators of axon growth capacity and important downstream signals of RGC axon growth cascades22, we examined if co-application of IGFBPL1 and IGF-1 or elevation of [Ca2+]i activates these signals. Western blot analysis showed that neither IGF-1 nor IGFBPL1 alone induced PI3K phosphorylation in P10 RGCs when compared to vehicle-treated controls (Fig. 8A–D). In contrast, co-administration of IGF-1 and IGFBPL1 induced a 6-fold increase in PI3K phosphorylation and a 3-fold increase of mTOR phosphorylation compared to the control group (Fig. 8A–D, Supplementary Fig. 5). Phosphorylation of PI3K and mTOR induced by IGFBPL1 and IGF-1 co-administration was completely blocked by Ca2+ chelator BAPTA (1,2-bis(o-amino phenoxy)ethane-N,N,N′,N′-tetraacetic acid). Administration of L-type Ca2+ channel activator FPL, in contrast, resulted in robust PI3K and mTOR activation, similar to that seen in cultures receiving IGFBPL1 and IGF-1 co-treatment (Fig. 8E,F). Together, our data establishes that IGFBPL1 functions as a co-factor of IGF-1 to enable axonal growth via signaling intracellular Ca2+-mediated events and activating PI3K and mTOR.
Discussion
The present study has identified a novel regulator and IGF-1 co-factor, IGFBPL1, in the mediation of RGC axon growth in vitro and in vivo. IGFBPL1 deficiency impaired axon growth, while administration of IGFBPL1 promoted RGC axonal growth in the presence of IGF-1. We demonstrate that presence of IGFBPL1 enables IGF-1 to activate intracellular Ca2+ signaling and PI3K and mTOR pathways and stimulate axon growth. The study unveils a new regulatory element in the pleiotropic functions of IGF-1.
During neural development, IGF-1 regulates many, and sometimes dichotomous, aspects of intracellular signals that support neural survival, differentiation, proliferation, axon growth, and synaptogenesis23. It is evident that IGF-1 regulates the initiation of axon growth and specification during development24,25; whereas, it promotes only neuronal survival without stimulating axon growth or regeneration in the adult CNS24,26,27,28. The molecular mechanisms underlying the shift of the pleiotropic activities of IGF-1 at various neuron developmental stages are unknown. Our study suggests that IGFBPL1, which is transiently expressed during the period of exuberant axon growth in development, is an essential co-factor of IGF-1 to enable the axon growth signaling. Restrained IGFBPL1 expression during distinct stages of RGC development thus may set the timing for RGC axon elongation. Up to date, little is reported regarding the transcriptional regulation of IGFBPL1 expression. There is much to be discovered about the functional roles for IGFBPL1 and to elucidate if IGFBPL1 also acts independent of IGF-1 to drive other cellular functions during development and response to neural injury or stress. In any case, these studies define a previously unknown signaling loop in IGF-1 function and reveal a novel mechanism that switches off the axonal growth activity of IGF-1.
Our results showed that IGFBPL1 functions through interacting with IGF-1 to enable intracellular Ca2+ signaling and initiate the axon growth program, such as the phosphorylation of PI3K and mTOR. IGF-1 mediates Ca2+ signaling pathways via activation of voltage-dependent Ca2+ channels and Akt phosphorylation29,30. Ca2+ as a second messenger plays pivotal roles in a variety of cellular processes in neurons, ranging from gene expression, neurite growth, synaptogenesis, to neurotransmitter release31. Excessive intracellular Ca2+ can also signal biochemical pathways initiating inflammation, free radical generation, and apoptosis32. Subcellular localization or transfer of Ca2+ from the endoplasmic reticulum (ER) to the mitochondria is important in the control of pro-survival/pro-death pathways. We previously reported that when injury-induced influx of Ca2+ is taken up by the mitochondria, it initiates apoptosis. Blockade of Ca2+ uptake by the ER and mitochondria via overexpressing Bcl-2 results in elevation of intracellular Ca2+ that in turn triggers signaling cascades of CREB (cAMP response element-binding protein) and Erk (Extracellular receptor kinase) and elicits neurite outgrowth and axon regeneration8. During development, elevated levels of intracellular Ca2+ 8,33 and mTOR phosphorylation22 are distinguishing features of neurons which actively extend axons34,35. These dynamics of intracellular Ca2+ level change and mTOR activation correlate with the expression of IGFBPL1 in the develo** retina, supporting a role for IGFBPL1 in this regulation. Studies have shown that IGFBPL1 is widely localized in the develo** mouse brain with a spatiotemporal pattern closely coincides with the time window when neurons are extending axons, but restricted to late-born neurons in the postnatal stage36. These observations suggest a conserved mechanism which may involve IGFBPL1 in controlling axonal growth in other CNS regions.
The relatively mild impact of gene deletion of IGFBPL1 on RGC axon growth in vivo implicates functional redundancy or existence of parallel pathways in the mediation of IGF-1 signaling. To date, at least 7 IGFBPs have been identified, and the involvement of these proteins in axon growth have not been well characterized. Our screening for other IGFBP members during the period of exuberant RGC axon growth detected dynamic expression of other IGFBPs in the develo** retina. It remains possible that other IGFBP family members may carry out parallel functional roles as IGFBPL1 to mediate the axon growth signaling of IGF-1. Moreover, many transcription factors, including p53, SnoN, E47, CREB, STAT3, NFAT, c-Jun, ATF3, Sox4, Sox11, NFκB, PTEN, KLFs, etc., have been shown to regulate neurite growth in vitro and in vivo37,38,39. Screening of these transcription factors in Igfbpl1−/− mice suggests that IGFBPL1 critically regulates ATF3 and KLF4 expression in develo** RGCs (unpublished data). Uncovering the specific subsets of transcription factors underlying the secretory factor IGFBPL1 or hormonal control of axon growth is not only of potential therapeutic importance, but would also further our understanding for the mechanisms of nerve regeneration. In the future, it would be most interesting also to elucidate how IGFBPL1/IGF-1 signaling participates in the regulation of axon development and if other IGFBPs play an agonistic or antagonistic role in IGF-1-mediated axon growth activities.
In summary, the present study has revealed a novel secretory factor that participates in the activation of the axon growth machinery in develo** RGCs through an IGF-1-dependent mechanism. These findings offer new perspectives for contemplating axon development regulation and regeneration and provide additional guidance in develo** new therapeutic approaches to treat optic nerve injury and degeneration.
Materials and Methods
Mice
C57BL/6 J wild-type (Charles River Laboratories) and Igfbpl1−/− mice at a C57BL/6 J genetic background (Knockout Mouse Project Repository, University of California at Davis) were used in these experiments. All mouse studies were approved by the Schepens Eye Research Institute Animal Care and Use Committee and performed in accordance with institutional and federal guidelines.
Immunohistochemistry
Retinal sections (10 μm thickness) and retinal whole-mounts were prepared, and immunofluorescent labeling was performed as previously described40. Retinal whole-mounts were incubated with primary antibody for 24 hours at 4 °C, followed by three washes in 0.01 M Phosphate buffered saline and incubation with secondary antibody for 2 hours at room temperature. Retinal whole-mounts or sections were then mounted with VECTORSHIELD mounting medium containing DAPI (Vector Laboratories). Primary antibodies against Tuj1 (Millipore, 1:800), IGF-1 (R&D systems, 1:50), and IGFBPL1 (R&D systems, 1:50) were used. As antibody specificity or negative controls for IGF-1 and IGFBPL1, the primary antibodies were omitted from the staining procedure, and P0 retinal sections (located in the same sections) which stain specifically with the primary antibody were used as positive controls. The specimens were visualized and photographed under Leica confocal microscope.
For RGC counting, retinal flat-mounts were divided into quadrants using the optic nerve head (ONH) as the origin: superior, temporal, nasal and inferior. Within each quadrant, four squares (198 µm × 198 µm) distributed at a 1 mm interval along the radius were selected: one from the peripheral region (2 mm from the ONH), two from the intermediate region (1 mm from the ONH), and one from the central region. Thus, total 16 square regions of each eye were photographed, and all Tuj1+ cells in the ganglion cell layer were counted. Average RGC densities of the entire retina were calculated.
Immunocytochemistry was used to determine RGC cell survival, axonal growth, and activation of signaling molecules including PI3K and mTOR. Briefly, cultured RGCs in 96-well plate were fixed with 2% paraformaldehyde for 15 min followed by immunostaining with primary antibodies against RGC marker Tuj1 (Millipore, 1:800), Phospho-PI3K (Cell Signaling, 1:50), or Phospho-mTOR (Cell Signaling, 1:50). Corresponding secondary antibodies were obtained from Jackson ImmunoResearch Laboratories Inc. Confocal images were acquired using a Leica confocal microscope and the LAS AF software. At least 8 images were acquired from each well. The longest axon of each cell, the number of cells bearing axons, and the fluorescent intensity of phosphor-PI3K or phosphor-mTOR were measured using ImageJ. All assays were repeated at least 4–6 times, and quantifications were carried out in a double-blind fashion.
Quantitative RT-PCR
RNA was prepared from freshly dissected retinas and cDNA was synthesized using the SuperScript® III First-Strand Synthesis System (Life Technologies). Quantitative PCR was performed using KAPA SYBR® FAST 2× qPCR Master Mix (Kapa Biosystems) and Eppendorf Mastercycler ep realplex2 (Eppendorf North America). Primers used in this study: IGFBPL1 Forward 5′ CTGTATGACCCTGGGCAAGT 3′; Reverse 5′ GCCAGACCCAATTACGTGTT 3′; GAPDH Forward 5′ AACTTTGGCATTGTGGAAGG 3′; Reverse 5′ TGTTCCTACCCCCAATGTGT 3′.
Neuron culture preparation and quantification for cell survival and neurite growth
Purification of RGCs was performed as previously described41. RGCs (5 × 104 cells/well) were seeded in 96-well culture plates that were pre-coated with Poly-D-Lysine (Millipore, 0.1 mg/ml) and merosin (EMD Millipore, 5 μg/ml), and maintained in a humidified tissue culture incubator in the presence of 5% CO2 for 3 days. In some experiments, the following reagents or chemicals were added into the culture medium immediately after the cells were seeded: recombinant mouse IGF-1 (R&D systems), recombinant mouse IGFBPL1 (R&D systems), H-135624,42 (Bachem, 40 μM), and NBI-3177243. In brief, the retinas were homogenized, and 30–50 μg of total protein from retina homogenates were run on a 4–20% polyacrylamide gel. Membranes were blocked with 25 mM Tris·Cl (pH 7.5) buffer containing 5% non-fat milk, and probed with appropriate primary and secondary antibodies. The IRDy®-conjugated secondary antibodies were visualized with the LI-COR Odyssey® system, and the horseradish peroxidase (HRP)-conjugated secondary antibodies (Pierce, Rockford, IL). Signals were detected with enhanced SuperSignal West Chemiluminescent Substrates on CL-XPosure Film (Thermo Scientific).
Measurement of [Ca2+]i
RGCs were cultured for 48 hours in multi-chamber culture slides pre-coated with Poly-D-Lysine and merosine. Cells were loaded with 1 μM Fura-2 and 8 μM pluronic acid F127 in the culture medium at 37 °C tissue culture incubator for 30 min. Cells were then washed twice with mammalian Ringer’s solution and maintained in Ringer’s solution containing 250 μM sulfinpyrazone for calcium imaging. Recombinant mouse IGF-1 and IGFBPL1 were dissolved in Ringer’s solution containing 250 μM sulfinpyrazone. Real-time imaging of intracellular calcium was acquired using a ratio imaging system InCyt Im2 (Intracellular Imaging, Cincinnati, OH) at the excimer wavelengths of 340 and 380 nm and an emission wavelength of 505 nm. Data was presented as the actual [Ca2+]i with time.
Treatment of cultures with calcium modulators
RGCs were purified and cultured with the presence or absence of IGFBPL1 + IGF-1 and chemicals that modulate intracellular calcium levels for three days. The calcium chelators EGTA (0.1 mM) and the calcium channel blocker Nifedipine (25 μM) were used to lower intracellular calcium concentration [Ca2+]i; the L-type calcium channel activator FPL-64176 (0.5 μM) was used to increase [Ca2+]i. After three days of treatment, cells were loaded with Calcein AM for axonal growth measurements.
Axon counts in optic nerve cross sections
Mouse optic nerve samples were fixed with half-strength Karnovsky’s fixative. Semi-thin optic nerve cross sections (1.0 μm) taken at 2 mm posterior to the globe were stained with 2% paraphenylenediamine aqueous solution to stain the axons. Twelve square regions (22.05 µm × 20.64 µm) distributed at four quadrants, of which 4 were taken from the central region and 8 from the peripheral region, were photographed. Using ImageJ, all axons in the photomicrographs were automatically counted and the areas of the optic nerve sections were measured. Axonal density was recorded, and the total axon number per optic nerve was calculated as (axon density x total area of the nerve cross section). All quantification procedure was carried out in a masked fashion.
References
Bregman, B. S. Regeneration in the spinal cord. Curr Opin Neurobiol 8, 800–807 (1998).
Chen, D. F. & Tonegawa, S. Why do mature CNS neurons of mammals fail to re-establish connections following injury–functions of bcl-2. Cell Death Differ 5, 816–822 (1998).
Goldberg, J. L. & Barres, B. A. The relationship between neuronal survival and regeneration. Annu Rev Neurosci 23, 579–612 (2000).
Horner, P. J. & Gage, F. H. Regenerating the damaged central nervous system. Nature 407, 963–970 (2000).
Chen, D. F., Jhaveri, S. & Schneider, G. E. Intrinsic changes in develo** retinal neurons result in regenerative failure of their axons. Proc Natl Acad Sci USA 92, 7287–7291 (1995).
Chen, D. F., Schneider, G. E., Martinou, J. C. & Tonegawa, S. Bcl-2 promotes regeneration of severed axons in mammalian CNS. Nature 385, 434–439 (1997).
Goldberg, J. L., Klassen, M. P., Hua, Y. & Barres, B. A. Amacrine-signaled loss of intrinsic axon growth ability by retinal ganglion cells. Science 296, 1860–1864 (2002).
Jiao, J. et al. Bcl-2 enhances Ca(2+) signaling to support the intrinsic regenerative capacity of CNS axons. EMBO J 24, 1068–1078 (2005).
Chen, H. et al. Optic neuropathy due to microbead-induced elevated intraocular pressure in the mouse. Invest Ophthalmol Vis Sci 52, 36–44 (2011).
Fischer, D., He, Z. & Benowitz, L. I. Counteracting the Nogo receptor enhances optic nerve regeneration if retinal ganglion cells are in an active growth state. J Neurosci 24, 1646–1651 (2004).
Allen, G. W., Liu, J., Kirby, M. A. & De Leon, M. Induction and axonal localization of epithelial/epidermal fatty acid-binding protein in retinal ganglion cells are associated with axon development and regeneration. J Neurosci Res 66, 396–405 (2001).
Perez-Rico, C., de la Villa, P., Reinoso-Suarez, F. & Gomez-Ramos, P. Kainic acid intraocular injections during the postnatal critical period induce plastic changes in the visual system. Neurosci Res 63, 244–250 (2009).
Kim, I. J., Zhang, Y., Meister, M. & Sanes, J. R. Laminar restriction of retinal ganglion cell dendrites and axons: subtype-specific developmental patterns revealed with transgenic markers. J Neurosci 30, 1452–1462 (2010).
Liu, X. J., **e, Q., Zhu, Y. F., Chen, C. & Ling, N. Identification of a nonpeptide ligand that releases bioactive insulin-like growth factor-I from its binding protein complex. J Biol Chem 276, 32419–32422 (2001).
Bondy, C. & Chin, E. IGF-I mRNA localization in trigeminal and sympathetic nerve target zones during rat embryonic development. Adv Exp Med Biol 293, 431–437 (1991).
Connolly, M. J., Prieto-Lloret, J., Becker, S., Ward, J. P. & Aaronson, P. I. Hypoxic pulmonary vasoconstriction in the absence of pretone: essential role for intracellular Ca2+ release. The Journal of physiology 591, 4473–4498 (2013).
de la Fuente, S., Fonteriz, R. I., Montero, M. & Alvarez, J. Ca2+ homeostasis in the endoplasmic reticulum measured with a new low-Ca2+-affinity targeted aequorin. Cell calcium 54, 37–45 (2013).
Nguemo, F. et al. The L-type Ca2+ channels blocker nifedipine represses mesodermal fate determination in murine embryonic stem cells. PLoS One 8, e53407 (2013).
Rosales, C. & Brown, E. J. Calcium channel blockers nifedipine and diltiazem inhibit Ca2+ release from intracellular stores in neutrophils. J Biol Chem 267, 1443–1448 (1992).
Armstrong, G. A. & Drapeau, P. Calcium channel agonists protect against neuromuscular dysfunction in a genetic model of TDP-43 mutation in ALS. The Journal of neuroscience: the official journal of the Society for Neuroscience 33, 1741–1752 (2013).
McDonough, S. I., Mori, Y. & Bean, B. P. FPL 64176 modification of Ca(V)1.2 L-type calcium channels: dissociation of effects on ionic current and gating current. Biophysical journal 88, 211–223 (2005).
Park, K. K. et al. Promoting axon regeneration in the adult CNS by modulation of the PTEN/mTOR pathway. Science 322, 963–966 (2008).
O’Kusky, J. & Ye, P. Neurodevelopmental effects of insulin-like growth factor signaling. Front Neuroendocrinol 33, 230–251.
Ozdinler, P. H. & Macklis, J. D. IGF-I specifically enhances axon outgrowth of corticospinal motor neurons. Nat Neurosci 9, 1371–1381. Epub 2006 Oct 1322. (2006).
Sosa, L. et al. IGF-1 receptor is essential for the establishment of hippocampal neuronal polarity. Nat Neurosci 9, 993–995 (2006).
Gutierrez-Ospina, G., Gutierrez de la Barrera, A., Larriva, J. & Giordano, M. Insulin-like growth factor I partly prevents axon elimination in the neonate rat optic nerve. Neurosci Lett 325, 207–210 (2002).
Hollis, E. R. II., Lu, P., Blesch, A. & Tuszynski, M. H. IGF-I gene delivery promotes corticospinal neuronal survival but not regeneration after adult CNS injury. Exp Neurol 215, 53–59 (2009).
Kermer, P., Klocker, N., Labes, M. & Bahr, M. Insulin-like growth factor-I protects axotomized rat retinal ganglion cells from secondary death via PI3-K-dependent Akt phosphorylation and inhibition of caspase-3 In vivo. J Neurosci 20, 2–8 (2000).
Blair, L. A. & Marshall, J. IGF-1 modulates N and L calcium channels in a PI 3-kinase-dependent manner. Neuron 19, 421–429 (1997).
Kim, Y. K. et al. Mechanism of enhanced cardiac function in mice with hypertrophy induced by overexpressed Akt. J Biol Chem 278, 47622–47628 (2003).
Jaskova, K., Pavlovicova, M. & Jurkovicova, D. Calcium transporters and their role in the development of neuronal disease and neuronal damage. Gen Physiol Biophys 31, 375–382 (2012).
Joshi, A. U., K., Oa & M.-R., D. The entangled ER-mitochondrial axis as a potential therapeutic strategy in neurodegeneration: A tangled duo unchained. Cell Calcium 60, 218–234 (2016).
Dunican, D. J. & Doherty, P. The generation of localized calcium rises mediated by cell adhesion molecules and their role in neuronal growth cone motility. Molecular cell biology research communications: MCBRC 3, 255–263 (2000).
de Lima, S., Habboub, G. & Benowitz, L. I. Combinatorial therapy stimulates long-distance regeneration, target reinnervation, and partial recovery of vision after optic nerve injury in mice. Int Rev Neurobiol 106, 153–172 (2012).
Sun, F. et al. Sustained axon regeneration induced by co-deletion of PTEN and SOCS3. Nature 480, 372–375 (2011).
Gonda, Y. et al. Expression profiles of Insulin-like growth factor binding protein-like 1 in the develo** mouse forebrain. Gene Expr Patterns 7, 431–440 (2007).
Moore, D. L. & Goldberg, J. L. Multiple transcription factor families regulate axon growth and regeneration. Dev Neurobiol 71, 1186–1211 (2011).
Cho, K. S. & Chen, D. F. Promoting optic nerve regeneration in adult mice with pharmaceutical approach. Neurochem Res 33, 2126–2133 (2008).
Watson, F. L. et al. Cell type-specific translational profiling in the Xenopus laevis retina. Dev Dyn 241, 1960–1972 (2012).
Guo, C., Hirano, A. A., Stella, S. L. II., Bitzer, M. & Brecha, N. C. Guinea pig horizontal cells express GABA, the GABA-synthesizing enzyme GAD 65, and the GABA vesicular transporter. J Comp Neurol 518, 1647–1669 (2010).
Ma, J. et al. Transplantation of Human Neural Progenitor Cells Expressing IGF-1 Enhances Retinal Ganglion Cell Survival. PLoS One 10, e0125695 (2015).
Pietrzkowski, Z., Wernicke, D., Porcu, P., Jameson, B. A. & Baserga, R. Inhibition of cellular proliferation by peptide analogues of insulin-like growth factor 1. Cancer research 52, 6447–6451 (1992).
Guo, C., Stella, S. L. Jr., Hirano, A. A. & Brecha, N. C. Plasmalemmal and vesicular gamma-aminobutyric acid transporter expression in the develo** mouse retina. J Comp Neurol 512, 6–26 (2009).
Acknowledgements
We thank Drs. Petr Baranov and Salvatore L. Stella for technical support, Maria Ortega for animal care, Semion Kasuli for editing, and Dr. Andrius Kazlauskas for critical reading and comments on the manuscript. This work was supported by grants from the Department of Veterans Affairs (1I01RX000110), the Department of Defense (W81XWH-09-2-0091), the National Eye Institute (R01EY017641 and R01EY025259), the Lion’s Foundation grant to D. F. C., the National Eye Institute R21EY027067 to K.S.C. and the Molecular Bases of Eye Diseases training grant T32EY007145 from NEI/NIH to C.G.
Author information
Authors and Affiliations
Contributions
Chenying Guo, Kin-Sang Cho, Yingqian Li, Kissauo Tchedre – design, execution and interpretation of the findings, drafting and revising the manuscript. Christian Antolik, **zhong A Huang – design, execution and interpretation of the findings, and revising the manuscript. Jie Ma, Justin Chew, Tor Paaske Utheim, Honghua Yu, Muhammad Taimur A Malik, Nada Anzak – execution of the experiments and revising the manuscript. Dong Feng Chen – conception, design, interpretation of the findings, drafting and revising the manuscript.
Corresponding author
Ethics declarations
Competing Interests
C.G., K.-S.C., C.A., and D.F.C. are co-inventors on a pending patent application. The other authors declare no significant competing financial, professional, or personal interests that might influence the performance or presentation of the work described in this manuscript.
Additional information
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Guo, C., Cho, KS., Li, Y. et al. IGFBPL1 Regulates Axon Growth through IGF-1-mediated Signaling Cascades. Sci Rep 8, 2054 (2018). https://doi.org/10.1038/s41598-018-20463-5
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-018-20463-5
- Springer Nature Limited
This article is cited by
-
α-Synuclein oligomers potentiate neuroinflammatory NF-κB activity and induce Cav3.2 calcium signaling in astrocytes
Translational Neurodegeneration (2024)
-
Direct neuronal reprogramming of mouse astrocytes is associated with multiscale epigenome remodeling and requires Yy1
Nature Neuroscience (2024)
-
IGF-1 Combined with OPN Promotes Neuronal Axon Growth in Vitro Through the IGF-1R/Akt/mTOR Signaling Pathway in Lipid Rafts
Neurochemical Research (2023)
-
Neural precursor cells tune striatal connectivity through the release of IGFBPL1
Nature Communications (2022)
-
Coding and regulatory variants are associated with serum protein levels and disease
Nature Communications (2022)