Fbxw11 promotes the proliferation of lymphocytic leukemia cells through the concomitant activation of NF-κB and β-catenin/TCF signaling pathways

Wang, Lina; Feng, Wenli; Yang, **ao; Yang, Feifei; Wang, Rong; Ren, Qian; Zhu, **aofan; Zheng, Guoguang

doi:10.1038/s41419-018-0440-1

Fbxw11 promotes the proliferation of lymphocytic leukemia cells through the concomitant activation of NF-κB and β-catenin/TCF signaling pathways

Article
Open access
Published: 19 March 2018

Volume 9, article number 427, (2018)
Cite this article

Download PDF

You have full access to this open access article

Cell Death & Disease

Fbxw11 promotes the proliferation of lymphocytic leukemia cells through the concomitant activation of NF-κB and β-catenin/TCF signaling pathways

Download PDF

Lina Wang¹,
Wenli Feng¹^na1,
**ao Yang¹,
Feifei Yang¹,
Rong Wang¹,
Qian Ren¹,
**aofan Zhu¹ &
…
Guoguang Zheng ORCID: orcid.org/0000-0002-0829-3501¹

3072 Accesses
40 Citations
1 Altmetric
Explore all metrics

Abstract

The ubiquitin–proteasome system (UPS) participates in both physiological and pathological processes through the posttranslational regulation of intracellular signal transduction pathways. F-box and WD-40 domain protein 11 (Fbxw11) is a component of the SCF (Skp1–Cul1–F-box) E3 ubiquitin ligase complex. Fbxw11 regulates various signal transduction pathways, and it may have pathological roles in tumorigenesis. However, the role of Fbxw11 in the development of leukemia and the underlying mechanisms remain largely unknown. In this study, Fbxw11 expression was aberrantly upregulated in patients with lymphocytic leukemia. Its expression was dramatically decreased in patients who achieved complete remission (CR) after chemotherapy. The high level of Fbxw11 expression in L1210 lymphocytic leukemia cells stimulated cell proliferation in vitro and tumor formation in vivo. The effects were mediated by the stimulation of cell cycle progression rather than the induction of apoptosis. Furthermore, a bioinformatics analysis suggested concomitant activation of the NF-κB and β-catenin/TCF signaling pathways, which were confirmed by reporter gene assays. Moreover, blocking experiments suggested the involvement of both pathways in the growth-promoting effects of Fbxw11. Our results reveal the role of Fbxw11 in lymphocytic leukemia cells and imply that Fbxw11 may serve as a potential molecular target for the treatment of lymphocytic leukemia.

FBXO21 mediated degradation of p85α regulates proliferation and survival of acute myeloid leukemia

Article Open access 09 September 2023

FBXO32 suppresses breast cancer tumorigenesis through targeting KLF4 to proteasomal degradation

Article 09 January 2017

A negative feedback loop between XBP1 and Fbw7 regulates cancer development

Article Open access 19 February 2019

Introduction

Hematopoiesis is strictly regulated by complicated intercellular communication from the hematopoietic microenvironment through sophisticated signal transduction networks. Dysregulation of signal transduction will disrupt the balance of normal hematopoiesis and cause various blood diseases. Leukemia is regarded as a clonal disease^1,2, and many intrinsic and extrinsic factors have been verified to play parts in the initiation and development of leukemia^3,4. During leukemogenesis, leukemia cells outcompete their normal counterparts and become dominant due to their high capacity for self-renewal and low capacity for apoptosis⁵. Diverse intrinsic abnormalities, which endow leukemia cells with those characteristics, have been elucidated at different levels, including mRNA transcriptional control, protein translation, and posttranslational modifications^6,7,8,9,10.

The ubiquitin–proteasome system (UPS), which is the main pathway for the degradation of short-period proteins in cells, is involved in the posttranslational regulation of numerous intracellular signal transduction pathways¹¹. The Skp1/cullin/F-box (SCF) complex is an important E3 ubiquitin ligase. F-box family proteins, which are further divided into Fbxw, Fbxl, and Fbxo subfamilies based on protein structure, determine the specificity of substrate degradation by identifying and binding to different target proteins¹². Abnormal expression or dysfunction of several F-box proteins results in aberrant ubiquitination, inducing the development and progression of malignancies, including hematopoietic malignancies. Some F-box family members contribute to tumorigenesis and tumor development^13,14,15. Fbxw7 controls leukemia-initiating cells in chronic myelogenous leukemia and chronic myeloid leukemia (CML) by regulating c-Myc ubiquitination^16,17,18. Fbxo11 loss or mutation induces impairments in BCL6 degradation, and therefore BCL6 accumulation contributes to pathogenesis of diffuse large B-cell lymphomas¹⁹. In addition, the E3 ligase family members Fbxl2, Fbxl10, and SKP2 participate in the proliferation of leukemia cells by regulating the ubiquitination pathway^20,21,22. To date, the effects of other members in the F-box family on the development of hematopoietic malignancies have not been established.

F-box and WD repeat domain containing 11 (Fbxw11), also known as HOS or β-TrCP2, belongs to the Fbxw subfamily of the F-box protein family²³. Fbxw11 is crucial for embryonic development, and the most obvious defect in Fbxw11^−/− mice is embryonic mortality²⁴. Fbxw11 plays pivotal roles in various signaling pathways by regulating the ubiquitination of phosphorylated substrates. The SCF^Fbxw11 complex regulates many important biological processes, including the cell cycle, differentiation, development, and metabolism, by targeting a broad range of substrates, including IκB, β-catenin, ATF4, Emi1, etc.^{25,Full size image}

Fbxw11 promoted the expression of some proliferation-associated genes

Based on the results of the GO analysis of biological processes, the category associated with proliferation was selected for further analysis, and the selected genes are listed in Fig. 5a. Thirteen of these genes were reported to stimulate proliferation, and 9 were reported to suppress proliferation in previous studies. Plac8, Nanog, Emp2, Fasl, Tnfsf18, Arg1, Gabbr1, and Plxnb1 were selected and verified by real-time PCR. With the exception of Arg1 in L1210-Fbxw11a cells, the expression of proliferation-promoting genes was upregulated while the expression of proliferation-suppressing genes was downregulated in L1210-Fbxw11a/c/d cells (Fig. 5b). These results were consistent with the gene array data. Cell cycle checkpoint genes were also analyzed to further examine the effects of Fbxw11 on the cell cycle. Most of these genes displayed low fold changes in the gene array data (Fig. 5c). However, levels of the Cyclin D1 protein, which is regulated by multiple transcription factors, including NF-κB and β-catenin, were significantly increased in L1210 cells expressing high levels of Fbxw11 transcript variants, according to the Western blot analysis (Fig. 5d). We designed a cyclin D1 shRNA to reverse of the effect of Fbxw11 on proliferation and validate the role of Cyclin D1 on the Fbxw11-induced increase in cell proliferation (Fig. 5e). As expected, knockdown of cyclin D1 decreased the proliferation of L1210 cells (Fig. 5f).

**Fig. 5: Analysis of proliferation-associated genes in L1210 cells expressing high levels of Fbxw11 variants.**

Fbxw11 might promote cell proliferation by activating both the NF-κB and β-catenin/TCF signaling pathways

As Cyclin D1 is downstream of both the NF-κB and β-catenin/TCF signaling pathways, we must determine which pathway is activated during the Fbxw11-mediated increase in proliferation. Hence, DEGs downstream of either NF-κB or β-catenin/TCF signaling pathway are plotted in Fig. 6a, b, respectively. The genes upregulated by Fbxw11 were summarized. Among these genes, upregulation of seven NF-κB-regulated genes in L1210-Fbxw11a/c/d cells was verified by real-time PCR, although slight differences in magnitude were observed among the three groups (Fig. 6c). Eight β-catenin/TCF-regulated genes were also verified by real-time PCR. The expression of Emp2, Lgr5, and Wisp1 was upregulated in L1210-Fbxw11a/c/d cells. Dll1, Ecel1, Nanog, Cldn1, and Trx3 were upregulated to various extents in L1210 cells expressing high levels of Fbxw11 transcript variants (Fig. 6d). A dual luciferase reporter system was also used. Activation of both the NF-κB and β-catenin/TCF signaling pathways was detected in 293T cells expressing high levels of Fbxw11 transcript variants (Fig. 6e, f). ICG-001 and JSH-23, inhibitors of the NF-κB and β-catenin/TCF pathways, were used to further confirm that both the NF-κB and β-catenin/TCF signaling pathways mediate the pro-proliferation effects on L1210-Fbxw11a/c/d cells. The administration of high doses of both inhibitors (5 μM for ICG-001 and 16 μM for JSH-23) completely diminished the pro-proliferation effects of Fbxw11 on L1210 cells. Furthermore, the administration of a combination of low doses of inhibitors (2 μM for ICG-001 and 8 μM for JSH-23) completely diminished the pro-proliferation effects of Fbxw11, although treatment with a low dose of either inhibitor had little effect (Fig. 6g). Based on the results of the apoptosis analysis, all dosages used in the experiments displayed little toxic effects (Figure S4). The above data suggested that Fbxw11 promoted the proliferation of L1210 cells by concomitantly activating the NF-κB and β-catenin/TCF signaling pathways.

**Fig. 6: Fbxw11 activated both the NF-κB and β-catenin/TCF signaling pathways.**

Discussion

The genesis and progression of leukemia are multifactorial processes that are regulated by a combination of microenvironmental and internal factors. The UPS is an important protein control system that participates in many physiological processes, such as cell proliferation, differentiation, and signal transduction. Dysfunction of ubiquitination or abnormal expression of UPS components is closely related to the occurrence of a variety of tumors and leukemia^16,20. In our previous study, we observed upregulation of Fbxw11 in HSPCs in a T-ALL microenvironment³⁶. However, little is known about the effects of Fbxw11 on leukemia cells. In the present study, Fbxw11 was aberrantly upregulated in patients with certain subtypes of ALL. Furthermore, high levels of Fbxw11 expression stimulated L1210 cell proliferation by regulating the cell cycle process. Moreover, both the NF-κB and β-catenin/TCF signaling pathways were activated in this process. Our results not only elucidate the significance of the Fbxw11-associated UPS in the progression of ALL but also provide new insights for leukemia research and clinical therapy.

The correlation between high levels of Fbxw11 expression and tumors has been reported in skin tumors and colorectal cancer, among others^33,37. In our study, Fbxw11 was expressed at higher levels in patients with newly diagnosed and relapsed ALL than in healthy control donors. The E3 ligases Fbxl2, Fbxl10, and SKP2 participate in the proliferation of leukemia cells^20,21,22. According to previous studies, β-TrCP (including β-TrCP1 and Fbxw11) is involved in regulating cell division³⁸. Here we detected the growth-promoting effects of Fbxw11 variants on L1210 cells both in vitro and in vivo. Based on the results of the apoptosis and cell cycle analyses, the effects were due to stimulation of the cell cycle rather than the induction of apoptosis. The bioinformatics analysis of microarray data showed that categories involved in the regulation of cell proliferation and positive regulation of T-cell proliferation were enriched in the GO biological process analysis. Furthermore, the upregulation of proliferation-associated genes was also validated. These results further confirmed that high levels of Fbxw11 expression promoted the proliferation of ALL cells, and three Fbxw11 variants exerted similar effects.

The mechanism by which Fbxw11 stimulated the proliferation of ALL cells was of interest. Enhanced constitutive activation of the NF-κB pathway has been observed in several human tumor cells. Activation of the NF-κB pathway upregulates cyclins, such as cyclin D1³⁹. Moreover, a series of inhibitors of the NF-κB pathway are degraded by F-box proteins, including Fbxw11^26,28,40,41. In our study, the category of the NF-κB signaling pathway had a high enrichment score in the KEGG analysis. Furthermore, a reporter gene assay provided direct evidence that high levels of Fbxw11 expression enhanced the transcriptional activity of the NF-κB signaling pathway. Moreover, upregulation of cyclin D1 was detected in L1210 cells expressing high levels of Fbxw11 variants. These results suggested that the NF-κB-cyclinD pathway was activated by Fbxw11 to stimulate the proliferation of ALL cells.

The β-catenin/TCF signaling pathway is implicated in many types of human tumors²³. Accumulation and nuclear translocation of β-catenin leads to the activation of TCF transcription factors, followed by the induction of transcription of a number of proliferation-associated genes, including cyclin D1⁴². Fbxw11 recognizes β-catenin and is involved in its degradation^26,43. In our study, the Wnt/β-catenin pathway was simultaneously activated in the three groups expressing high levels of Fbxw11 variants in the IPA analysis (Fig. 4f). The reporter gene assay further confirmed that Fbxw11 overexpression promoted the transcriptional activity of the β-catenin/TCF signaling pathway. The mechanism is not clear. However, a similar phenomenon has also been observed for other F-box proteins. For example, EDD3, FANCL, and RAD6B interact with β-catenin, leading to their ubiquitination. However, high levels of those F-box proteins increase the level of the β-catenin protein and the activation of the β-catenin pathway^44,45,46. These results suggest that β-catenin/TCF signaling pathway is also activated by Fbxw11 to stimulate the proliferation of leukemia cells.

Studies on the mechanism of Fbxw11 in malignant cells in the literature have mainly focused on either the NF-κB or β-catenin signaling pathway^23,47. However, both of these pathways converge to regulate the activity of the cyclin D1 gene promoter^39,47,48. Intriguingly, both the NF-κB and β-catenin/TCF signaling pathways were activated in L1210 cells expressing high levels of Fbxw11 in the present study. Inhibitors of the two signaling pathways were used to test their effects on cell proliferation and further confirm the concomitant involvement of the two pathways. Treatment with a combination of low doses of the inhibitors completely diminished the pro-proliferation effects of Fbxw11, although treatment with a low dose of either inhibitor alone had little effect. These results suggest that increased activities of the SCF^Fbxw11 E3 ubiquitin ligase in ALL cells promotes cell proliferation by accelerating cell cycle events through concomitant activation of the NF-κB and β-catenin/TCF signaling pathways.

Taken together, Fbxw11 expression is upregulated in patients with ALL. High levels of Fbxw11 expression stimulate the proliferation of L1210 lymphocytic leukemia cells in vitro and promote tumor formation in vivo by regulating the cell cycle. Most importantly, activation of both the NF-κB and β-catenin/TCF signaling pathways is involved in this process. This work reveals the role of Fbxw11 in the proliferation of lymphocytic leukemia cells and implies that Fbxw11 may serve as a potential molecular target for the treatment of lymphocytic leukemia.

Materials and methods

Leukemia samples

BM samples were obtained from pediatric patients with AL who were aged <18 years at the initial diagnosis from the Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College. Patients included 60 individuals with newly diagnosed ALL, 59 with newly diagnosed acute myelocytic leukemia, 12 with relapsed ALL, and 15 with ALL in CR. Among the 15 patients with ALL in CR, only 7 cases had samples at newly diagnosed stage and they were also included in the 60 newly diagnosed ALL group. These seven cases were chosen for follow-up study to compare Fbxw11 expression in patients before and after standard chemotherapy achieving CR. Bone marrow mononuclear cells were obtained by Ficoll-Hypaque density gradient centrifugation. Approval was obtained from the Institutional Research Board at Blood Disease Hospital prior to the initiation of this study.

Reagents and vectors

PRMI-1640, fetal bovine serum (FBS), and M-MLV reverse transcriptase were purchased from Thermo Fisher Scientific (Carlsbad, CA). The SYBR Premix Ex Taq Kit was obtained from TaKaRa Biotech (Dalian, China). The monoclonal antibody against mouse Fbxw11 was purchased from Sigma-Aldrich (St. Louis, MO). The enhanced chemiluminescence detection kit was purchased from Millipore (Bedford, MA). The lentivirus-based vector pLV-EF1α-MCS-IRES-Bsd (Cat# cDNA-pLV03) and pLV-H1-EF1α-red (Cat# SORT-B11) were obtained from Biosettia Inc. (San Diego, CA).

Cell lines

The L1210 cell line was purchased from ATCC and stored at the cell bank of the State Key Laboratory of Experimental Hematology (SKLEH). L1210 cells were infected with lentiviruses carrying Fbxw11 variants. After sorting by flow cytometry, the GFP⁺ stably transfected cell lines were named L1210-control, L1210-Fbxw11a, L1210-Fbxw11c, and L1210-Fbxw11d, respectively. All cells were maintained in RPMI 1640 medium supplemented with 10% FBS, glutamine (2 mM), penicillin (100 U/ml), and streptomycin (100 μg/ml), at 37 °C in 5% CO₂ atmosphere.

cDNA synthesis and real-time RT-PCR

The cDNA templates were prepared using a previously described method⁴⁹. Briefly, total RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) and cDNAs were then synthesized using M-MLV reverse transcriptase (Invitrogen), according to the manufacturer’s instructions. Real-time PCR was performed using an ABI 7500 Sequence Detector System (Applied Biosystems, Foster City, CA). The expression level of target genes was obtained from at least three independent experiments by calculating the RQ value using the ^ΔΔCt method [^ΔΔCt = (Ct_TARGET−Ct_GAPDH) sample−(Ct_TARGET−Ct_GAPDH) calibrator]. The sequences of all primers are listed in Table 1 in the supplementary materials. For each gene, the RQ value of L1210-control was designated 1.00.

Western blot

Total protein was extracted from cells using lysis buffer (Cell Signaling Technology, Danvers, MA) supplemented with protease inhibitors and phenylmethanesulfonylfluoride. Separation on sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels, transfer to polyvinylidene difluoride (PVDF) membrane and film development were performed using a standard protocol⁵⁰. PVDF membranes were incubated with diluted primary antibodies (1:1000 for Fbxw11; QC13573, Sigma, St. Louis, MO) and 1:5000 for glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 97166, Cell Signaling, Danvers, MA) in TBST buffer containing 5% milk at 4 ℃ overnight. Western blots were repeated at least three times.

Cell cycle analysis

PI staining was used for the cell cycle analysis. Briefly, cells were harvested, suspended in phosphate-buffered saline (PBS) and fixed with 70% ethanol on ice for 1 h. Then cells were washed with PBS and RNA was digested with RNase. Haploid and diploid DNA were labeled with PI overnight. Ki-67/PI double staining was also employed to detect cells in G0 phase. Briefly, suspended cells were treated with Cytofix/Cytoperm buffer (BD Pharmingen) and stained with Ki-67-PE (Biolegend, San Diego, CA) and Hoechst33342 (Sigma). An LSRII flow cytometer was used for the cell cycle analysis according to standard protocols. Experiments were repeated at least three times.

Mouse model

Six-to-8-week-old female DBA2 mice were purchased from Bei**g Vital River Laboratory Animal Technology Co., Ltd. (Bei**g, China) and maintained in the animal center of SKLEH. All experiments were approved by the Institutional Animal Care and Use Committees of SKLEH. The dorsal surface of each mouse was subcutaneously. injected with 1 × 10⁶ cells in a volume of 200 μL. Tumor volumes were monitored weekly. Mice were sacrificed 4 weeks after cells were injected. Tumor volumes were calculated using the formula length × width²/2.

Immunofluorescence staining for the BrdU incorporation assay

Mice were intraperitoneally injected with 50 mg/kg BrdU 16 h prior to sacrifice. Tumors were isolated, fixed with 4% paraformaldehyde for 24 h, and then 5-µm-thick paraffin-embedded tissue sections were generated. Tissue sections were stained with an anti-BrdU antibody (Cell Signaling Technology, Danvers, MA) followed by DyLight^TM 649-conjugated goat anti mouse IgG (Biolegend, San Diego, CA) to determine the extent of BrdU incorporation in tumors. DAPI (4,6-diamidino-2-phenylindole) was used to counterstain the nuclei. Sections were scanned using a confocal laser scanning microscope (UltraView Vox, PerkinElmer, MA).

Microarray and data analysis

First, mRNAs were extracted from L1210-control, L1210-Fbxw11a, L1210-Fbxw11c, and L1210-Fbxw11d cells, respectively. An Agilent SurePrint G3 Mouse Gene Expression V 2.0 microarray was analyzed by Shanghai OE Biotech. Co., Ltd. using standard protocols. The microarray data are available in the National Center for Biotechnology Information Gene Expression Omnibus database under accession number GSE101725. DEGs in L1210-Fbxw11a, L1210-Fbxw11c, and L1210-Fbxw11d cells were normalized to L1210-control cells and filtered with a fold change ≥2.0 to obtain the three groups of DEGs. The intersections of these DEGs were analyzed by performing GO and KEGG pathway analyses using the FunNet online database. The significance of the gene enrichment in the considered GO and KEGG categories was calculated using a unilateral Fisher exact test (p-value) and a false discovery rate <0.01. The sum of these three groups of DEGs was also analyzed by a comparison analysis using the IPA software, and the common canonical pathway was obtained based on the activation z-score. The expression patterns among the different groups were analyzed using the MeV 4.9.0 software.

Knockdown Cyclin D1 by shRNA

shRNA sequences for silencing mouse Cyclin D1 were designed using RNAi designer from ThermoFisher website (http://rnaidesigner.thermofisher.com/rnaiexpress/index.jsp). The two shRNA sequences were synthesized as Cyclin D1-sh1 (AAAAGCTGCAAATGGAACTGCT TCTTTGGATCCAAAGAAGCAGTTCCATTTGCAGC) and Cyclin D1-sh2 (AAAAGGAA CAGATTGAAGCCCTTCTTTGGATCCAAAGAAGGGCTTCAATCTGTTCC). An shRNA targeting LacZ (AAAAGCAGTTATCTGGAAGATCAGGTTGGATCCAACCTGATCTTCCAGATAACTGC) was used as control for knockdown analysis. The single-stranded DNA oligos were annealed to form a double-strand oligos and ligated to the linearized pLV-H1-EF1α-red vector to construct shRNA vectors. L1210-control and L1210-Fbxw11c cells were infected with lentiviruses carrying different shRNA vectors, respectively. After sorting by flow cytometry, the RFP⁺ cells were used for further analysis. The efficacy of knockdown by shRNA was verified by real-time RT-PCR.

Statistical analysis

All quantitative data are presented as the means ± SEM and were analyzed using one-way analysis of variance (ANOVA) and followed by Dunnett’s post hoc multiple comparison test (to compare all columns with the control column). Two-way ANOVA followed by Bonferroni’s post hoc test was also used to analyze multiple factors. The significance of differences in Fbxw11 expression between ALL specimens and ALL-CR specimens was tested using a paired t-test. Data were analyzed using the GraphPad Prism software. Two-sided p-values <0.05 were considered statistically significant.

References

Yan, B., Ban, K. & Chng, W. J. Clonal hematopoiesis and blood-cancer risk. N. Engl. J. Med. 372, 1071 (2015).
Article PubMed Google Scholar
Jan, M., Ebert, B. L. & Jaiswal, S. Clonal hematopoiesis. Semin. Hematol. 54, 43–50 (2017).
Article PubMed Google Scholar
Chen, S. Y. et al. Organ-specific microenvironment modifies diverse functional and phenotypic characteristics of leukemia-associated macrophages in mouse T cell acute lymphoblastic leukemia. J. Immunol. 194, 2919–2929 (2015).
Article PubMed CAS Google Scholar
Zhu, X. et al. Identification of functional cooperative mutations of SETD2 in human acute leukemia. Nat. Genet. 46, 287–293 (2014).
Article PubMed PubMed Central CAS Google Scholar
Hu, X. et al. Kinetics of normal hematopoietic stem and progenitor cells in a Notch1-induced leukemia model. Blood 114, 3783–3792 (2009).
Article PubMed PubMed Central CAS Google Scholar
Mihashi, Y. et al. C-MYC and its main ubiquitin ligase, FBXW7, influence cell proliferation and prognosis in adult T-cell leukemia/lymphoma. Am. J. Surg. Pathol. 41, 1139–1149 (2017).
Article PubMed Google Scholar
Li, Z. et al. FTO plays an oncogenic role in acute myeloid leukemia as a N6-methyladenosine RNA emethylase. Cancer Cell 31, 127–141 (2017).
Article PubMed CAS Google Scholar
Pozzo, F. et al. NOTCH1-mutated chronic lymphocytic leukemia cells are characterized by a MYC-related overexpression of nucleophosmin 1 and ribosome-associated components. Leukemia 31, 2407–2415 (2017).
Article PubMed CAS Google Scholar
Garcia-Cuellar, M. P., Steger, J., Fuller, E., Hetzner, K. & Slany, R. K. Pbx3 and Meis1 cooperate through multiple mechanisms to support Hox-induced murine leukemia. Haematologica 100, 905–913 (2015).
Article PubMed PubMed Central CAS Google Scholar
Guo, H. et al. PBX3 is essential for leukemia stem cell maintenance in MLL-rearranged leukemia. Int. J. Cancer 141, 324–335 (2017).
Article PubMed CAS Google Scholar
Mukhopadhyay, D. & Riezman, H. Proteasome-independent functions of ubiquitin in endocytosis and signaling. Science 315, 201–205 (2007).
Article PubMed CAS Google Scholar
Metzger, M. B., Hristova, V. A. & Weissman, A. M. HECT and RING finger families of E3 ubiquitin ligases at a glance. J. Cell Sci. 125, 531–537 (2012).
Article PubMed PubMed Central CAS Google Scholar
Zhang, J. et al. The F-box protein FBXL18 promotes glioma progression by promoting K63-linked ubiquitination of Akt. FEBS Lett. 591, 145–154 (2017).
Article PubMed CAS Google Scholar
Kuchay, S. et al. PTEN counteracts FBXL2 to promote IP3R3- and Ca(2+)-mediated apoptosis limiting tumour growth. Nature 546, 554–558 (2017).
PubMed PubMed Central CAS Google Scholar
Kitade, S. et al. FBXW7 is involved in the acquisition of the malignant phenotype in epithelial ovarian tumors. Cancer Sci. 107, 1399–1405 (2016).
Article PubMed PubMed Central CAS Google Scholar
Reavie, L. et al. Regulation of c-Myc ubiquitination controls chronic myelogenous leukemia initiation and progression. Cancer Cell 23, 362–375 (2013).
Article PubMed PubMed Central CAS Google Scholar
Takeishi, S. et al. Ablation of Fbxw7 eliminates leukemia-initiating cells by preventing quiescence. Cancer Cell 23, 347–361 (2013).
Article PubMed CAS Google Scholar
King, B. et al. The ubiquitin ligase FBXW7 modulates leukemia-initiating cell activity by regulating MYC stability. Cell 153, 1552–1566 (2013).
Article PubMed PubMed Central CAS Google Scholar
Duan, S. et al. FBXO11 targets BCL6 for degradation and is inactivated in diffuse large B-cell lymphomas. Nature 481, 90–93 (2012).
Article PubMed PubMed Central CAS Google Scholar
Ueda, T. et al. Fbxl10 overexpression in murine hematopoietic stem cells induces leukemia involving metabolic activation and upregulation of Nsg2. Blood 125, 3437–3446 (2015).
Article PubMed PubMed Central CAS Google Scholar
Chen, B. B. et al. F-box protein FBXL2 targets cyclin D2 for ubiquitination and degradation to inhibit leukemic cell proliferation. Blood 119, 3132–3141 (2012).
Article PubMed PubMed Central CAS Google Scholar
Chen, J. Y., Wang, M. C. & Hung, W. C. Bcr-Abl-induced tyrosine phosphorylation of Emi1 to stabilize Skp2 protein via inhibition of ubiquitination in chronic myeloid leukemia cells. J. Cell. Physiol. 226, 407–413 (2011).
Article PubMed CAS Google Scholar
Fuchs, S. Y., Spiegelman, V. S. & Kumar, K. G. The many faces of beta-TrCP E3 ubiquitin ligases: reflections in the magic mirror of cancer. Oncogene 23, 2028–2036 (2004).
Article PubMed CAS Google Scholar
Nakagawa, T. et al. S6 kinase- and beta-TrCP2-dependent degradation of p19Arf is required for cell proliferation. Mol. Cell. Biol. 35, 3517–3527 (2015).
Article PubMed PubMed Central CAS Google Scholar
Lassot, I. et al. ATF4 degradation relies on a phosphorylation-dependent interaction with the SCF(betaTrCP) ubiquitin ligase. Mol. Cell. Biol. 21, 2192–2202 (2001).
Article PubMed PubMed Central CAS Google Scholar
Fuchs, S. Y., Chen, A., **ong, Y., Pan Z-q & Ronai, Z. HOS, a human homolog of Slimb, forms an SCF complex with Skp1 and Cullin1 and targets the phosphorylation-dependent degradation of IkB and b-catenin. Oncogene 18, 2039–2046 (1999).
Article PubMed CAS Google Scholar
Kitagawa, M. et al. An F-box protein, FWD1, mediates ubiquitin-dependent proteolysis of beta-catenin. EMBO J. 18, 2401–2410 (1999).
Article PubMed PubMed Central CAS Google Scholar
Shirane, M., Hatakeyama, S., Hattori, K., Nakayama, K. & Nakayama, K. Common pathway for the ubiquitination of IkappaBalpha, IkappaBbeta, and IkappaBepsilon mediated by the F-box protein FWD1. J. Biol. Chem. 274, 28169–28174 (1999).
Article PubMed CAS Google Scholar
Guardavaccaro, D. et al. Control of meiotic and mitotic progression by the F box protein beta-Trcp1 in vivo. Dev. Cell 4, 799–812 (2003).
Article PubMed CAS Google Scholar
Undi, R. B. et al. Wnt signaling: role in regulation of haematopoiesis. Indian J. Hematol. Blood Transfus. 32, 123–134 (2016).
Article PubMed Google Scholar
Fisher, D. A. et al. Mass cytometry analysis reveals hyperactive NF Kappa B signaling in myelofibrosis and secondary acute myeloid leukemia. Leukemia 31, 1962–1974 (2017).
Article PubMed CAS Google Scholar
Soldatenkov, V. A., Dritschilo, A., Ronai, Z. & Fuchs, S. Y. Inhibition of homologue of Slimb (HOS) function sensitizes human melanoma cells for apoptosis. Cancer Res. 59, 5085–5088 (1999).
PubMed CAS Google Scholar
Bhatia, N., Herter, J. R., Slaga, T. J., Fuchs, S. Y. & Spiegelman, V. S. Mouse homologue of HOS (mHOS) is overexpressed in skin tumors and implicated in constitutive activation of NF-kB. Oncogene 21, 1501–1509 (2002).
Article PubMed CAS Google Scholar
Bagger, F. O. et al. BloodSpot: a database of gene expression profiles and transcriptional programs for healthy and malignant haematopoiesis. Nucleic Acids Res. 44, D917–D924 (2016).
Article PubMed CAS Google Scholar
Koike, J., Sagara, N., Kirikoshi, H. & Takagi, A. Molecular cloning and genomic structure of the βTRCP2 gene on chromosome 5q35. 1. Biochem. Biophys. Res. Commun. 109, 103–109 (2000).
Article CAS Google Scholar
Tian, C. et al. Hes1 mediates the different responses of hematopoietic stem and progenitor cells to T cell leukemic environment. Cell Cycle 12, 322–331 (2013).
Article PubMed PubMed Central CAS Google Scholar
Ougolkov, A. et al. Associations among beta-TrCP, an E3 ubiquitin ligase receptor, beta-catenin, and NF-kappaB in colorectal cancer. J. Natl. Cancer Inst. 96, 1161–1170 (2004).
Article PubMed CAS Google Scholar
Wojcik, E. J., Glover, D. M. & Hays, T. S. The SCF ubiquitin ligase protein slimb regulates centrosome duplication in Drosophila. Curr. Biol. 10, 1131–1134 (2000).
Article PubMed CAS Google Scholar
Joyce, D. et al. NF-kappaB and cell-cycle regulation: the cyclin connection. Cytokine Growth Factor. Rev. 12, 73–90 (2001).
Article PubMed CAS Google Scholar
Yaron, A. et al. Inhibition of NF-kappa-B cellular function via specific targeting of the I-kappa-B-ubiquitin ligase. EMBO J. 16, 6486–6494 (1997).
Article PubMed PubMed Central CAS Google Scholar
Lang, V. et al. betaTrCP-mediated proteolysis of NF-kappaB1p105 requires phosphorylation of p105 serines 927 and 932. Mol. Cell. Biol. 23, 402–413 (2003).
Article PubMed PubMed Central CAS Google Scholar
Polakis, P. Wnt signaling and cancer. Genes Dev. 14, 1837–1851 (2000).
PubMed CAS Google Scholar
Hart, M. et al. The F-box protein beta-TrCP associates with phosphorylated beta-catenin and regulates its activity in the cell. Curr. Biol. 9, 207–210 (1999).
Article PubMed CAS Google Scholar
Hay-Koren, A., Caspi, M., Zilberberg, A. & Rosin-Arbesfeld, R. The EDD E3 ubiquitin ligase ubiquitinates and up-regulates beta-catenin. Mol. Biol. Cell 22, 399–411 (2011).
Article PubMed PubMed Central CAS Google Scholar
Dao, K. H. et al. FANCL ubiquitinates beta-catenin and enhances its nuclear function. Blood 120, 323–334 (2012).
Article PubMed PubMed Central CAS Google Scholar
Shekhar, M. P., Gerard, B., Pauley, R. J., Williams, B. O. & Tait, L. Rad6B is a positive regulator of beta-catenin stabilization. Cancer Res. 68, 1741–1750 (2008).
Article PubMed CAS Google Scholar
Polakis, P. Wnt signaling and cancer. Genes Dev. 14, 1837–1851 (2000).
PubMed CAS Google Scholar
Albanese, C. et al. IKKalpha regulates mitogenic signaling through transcriptional induction of cyclin D1 via Tcf. Mol. Biol. Cell 14, 585–599 (2003).
Article PubMed PubMed Central CAS Google Scholar
Chong, J. H. et al. Abnormal expression of P2X family receptors in Chinese pediatric acute leukemias. Biochem. Biophys. Res. Commun. 391, 498–504 (2010).
Article PubMed CAS Google Scholar
Wang, L. et al. Legumain: a biomarker for diagnosis and prognosis of human ovarian cancer. J. Cell. Biochem. 113, 2679–2686 (2012).
Article PubMed CAS Google Scholar

Download references

Acknowledgements

This work was supported by grants 81300376, 81570153, 81770183, and 81421002 from the National Natural Science Foundation of China (NSFC), programs 2016-I2M-2-006 and 2017-I2M-1-015 from the CAMS Initiative for Innovative Medicine, and grants 14JCQNJC10600 and 17JCZDJC35000 from the Tian** Natural Science Foundation. G.Z. is a recipient of the New Century Excellent Talents in University (NCET-08-0329).

Authors’ contributions

L.W. and G.Z. designed the experiments and wrote the paper. L.W., W.F., X.Y., and F.Y. performed the experiments. R.W., Q.R., and X.Z. analyzed the data. All authors have read and approved the final manuscript.

Author information

Edited by M. Diederich

Authors and Affiliations

State Key Laboratory of Experimental Hematology, Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, 288 Nan**g Road, 300020, Tian**, China
Lina Wang, Wenli Feng, **ao Yang, Feifei Yang, Rong Wang, Qian Ren, **aofan Zhu & Guoguang Zheng

Authors

Lina Wang
View author publications
You can also search for this author in PubMed Google Scholar
Wenli Feng
View author publications
You can also search for this author in PubMed Google Scholar
**ao Yang
View author publications
You can also search for this author in PubMed Google Scholar
Feifei Yang
View author publications
You can also search for this author in PubMed Google Scholar
Rong Wang
View author publications
You can also search for this author in PubMed Google Scholar
Qian Ren
View author publications
You can also search for this author in PubMed Google Scholar
**aofan Zhu
View author publications
You can also search for this author in PubMed Google Scholar
Guoguang Zheng
View author publications
You can also search for this author in PubMed Google Scholar

Corresponding authors

Correspondence to Lina Wang or Guoguang Zheng.

Ethics declarations

Conflict of interest

The authors declare that they have no conflict of interest.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Figure S1(TIF 6211 kb)

Figure S2(TIF 586 kb)

Figure S3(TIF 6552 kb)

Figure S4(TIF 13179 kb)

Supplemental figure legend(DOCX 12 kb)

Table 1(DOCX 16 kb)

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Wang, L., Feng, W., Yang, X. et al. Fbxw11 promotes the proliferation of lymphocytic leukemia cells through the concomitant activation of NF-κB and β-catenin/TCF signaling pathways. Cell Death Dis 9, 427 (2018). https://doi.org/10.1038/s41419-018-0440-1

Download citation

Received: 26 September 2017
Revised: 24 February 2018
Accepted: 27 February 2018
Published: 19 March 2018
DOI: https://doi.org/10.1038/s41419-018-0440-1
Springer Nature Limited

This article is cited by

Tet methylcytosine dioxygenase 2 (TET2) deficiency elicits EGFR-TKI (tyrosine kinase inhibitors) resistance in non-small cell lung cancer
- Jian Zhang
- Kejia Zhao
- Lunxu Liu
Signal Transduction and Targeted Therapy (2024)
FBXO22 promotes leukemogenesis by targeting BACH1 in MLL-rearranged acute myeloid leukemia
- **ao-Na Zhu
- Yu-Sheng Wei
- Guo-Qiang Chen
Journal of Hematology & Oncology (2023)
Intrathyroid thymic carcinoma: clinicopathological features and whole exome sequencing analysis
- Jiayu Li
- Run **ang
- Yang Liu
Virchows Archiv (2023)
Notch signaling pathway: a comprehensive prognostic and gene expression profile analysis in breast cancer
- Hassan Yousefi
- Afshin Bahramy
- Sadegh Babashah
BMC Cancer (2022)
Fbxw11 impairs the repopulation capacity of hematopoietic stem/progenitor cells
- Lina Wang
- Yongjun Piao
- Guoguang Zheng
Stem Cell Research & Therapy (2022)

Fbxw11 promotes the proliferation of lymphocytic leukemia cells through the concomitant activation of NF-κB and β-catenin/TCF signaling pathways

Abstract

Similar content being viewed by others

Introduction

Fbxw11 promoted the expression of some proliferation-associated genes

Fbxw11 might promote cell proliferation by activating both the NF-κB and β-catenin/TCF signaling pathways

Discussion

Materials and methods

Leukemia samples

Reagents and vectors

Cell lines

cDNA synthesis and real-time RT-PCR

Western blot

Cell cycle analysis

Mouse model

Immunofluorescence staining for the BrdU incorporation assay

Microarray and data analysis

Knockdown Cyclin D1 by shRNA

Statistical analysis

References

Acknowledgements

Authors’ contributions

Author information

Authors and Affiliations

Corresponding authors

Ethics declarations

Conflict of interest

Additional information

Electronic supplementary material

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Search

Navigation