Abstract
Background
Targeting epigenetic modifiers is effective in cutaneous T cell lymphoma (CTCL). However, there is a need for further improvement of this therapeutic approach. Here, we compared the mode of action of romidepsin (FK228), an established class I histone deacetylase inhibitor, and domatinostat (4SC-202), a novel inhibitor of class I HDACs, which has been reported to also target the lysine-specific histone demethylase 1A (LSD1).
Methods
We performed MTS assays and flow cytometric analyses of propidium iodide or annexin V-stained cells to assess drug impact on cellular proliferation, cell cycle distribution, and survival. Histone acetylation and methylation as well as caspase activation was analyzed by immunoblot. Gene expression analysis was performed using NanosString technology. Knockdown and knockout of LSD1 was achieved with shRNA and CRISPR/Cas9, respectively, while the CRISPR/Cas9 synergistic activation mediator system was used to induce expression of endogenous HDACs and LSD1. Furthermore, time-lapse fluorescence microscopy and an in vitro tubulin polymerization assay were applied.
Results
While FK228 as well as 4SC-202 potently induced cell death in six different CTCL cell lines, only in the case of 4SC-202 death was preceded by an accumulation of cells in the G2/M phase of the cell cycle. Surprisingly, apoptosis and accumulation of cells with double DNA content occurred already at 4SC-202 concentrations hardly affecting histone acetylation and methylation, and provoking significantly less changes in gene expression compared to biologically equivalent doses of FK228. Indeed, we provide evidence that the 4SC-202-induced G2/M arrest in CTCL cells is independent of de novo transcription. Furthermore, neither enforced expression of HDAC1 nor knockdown or knockout of LSD1 affected the 4SC-202-induced effects. Since time-lapse microscopy revealed that 4SC-202 could affect mitotic spindle formation, we performed an in vitro tubulin polymerization assay revealing that 4SC-202 can directly inhibit microtubule formation.
Conclusions
We demonstrate that 4SC-202, a drug currently tested in clinical trials, effectively inhibits growth of CTCL cells. The anti-cancer cell activity of 4SC-202 is however not limited to LSD1-inhibition, modulation of histone modifications, and consecutive alteration of gene expression. Indeed, the compound is also a potent microtubule-destabilizing agent.
Similar content being viewed by others
Background
Despite recent advances in basic and translational research in the field of cutaneous T cell lymphoma (CTCL) [1, 2], effective treatment options for advanced mycosis fungoides (MF) and Sézary syndrome (SS)—the two most common types of CTLC—are still limited. Usually, conventional therapies result in only short-lived remissions [3,4,5]. Recent genomic analysis revealed aberrations affecting apoptosis [6], cytokine, and T cell receptor signaling [Time-lapse microscopy Since live cell imaging turned out to be not feasible with suspension cells such as CTCL cell lines, adherent histone H2B-GFP and additionally RFP-tubulin expressing HeLa cells were used as a representative model for time-lapse microscopy. Cells were seeded into 4-well slides (ibidi®) in phenol red-free medium, and placed in a live cell imaging chamber that assured standard culture conditions (37 °C, 95% humidity, 5% CO2). Images were taken every 10 to 20 min using Eclipse Ti (Nikon). To knockdown LSD1, we first generated a selectable lentiviral one-vector system which allows Golden Gate cloning of an shRNA coding sequence under the control of a Doxycyclin (Dox)-inducible promoter (induc shRNA EYFP-P2A-Puro; Genbank: MH749464). As shRNA target sequence for LSD1, we used AGGCCTAGACATTAAACTGAA. Lentiviral supernatants were produced as previously described [52]. MyLa cells were infected and following puromycin selection, shRNA expression was induced by addition of 1 μg/ml Doxycyclin. To achieve an LSD1 knockout, we first cloned an oligonucleotide sequence targeting CGCGGAGGCTCTTTCTTGCG in exon 1 of the LSD1 gene into the LentiGuide-BSD vector, which had been derived from LentiGuide-Puro [53] (kind gift from Feng Zhang; Addgene plasmid #52963) by replacing the puromycin with a blasticidin resistance. Virus generated with this LentiGuide-BSD-LSD1 construct was used to infect HeLa cells stably expressing Cas9, due to prior transduction with the lentiviral pcdh puro Cas9 followed by Puromycin selection. Blasticidin-resistant single-cell clones were established, and clones lacking LSD1 expression were identified by immunoblot. Knockout was confirmed by sequencing of the genomic region targeted by the LSD1 guide RNA. siRNAs targeting HDAC1 and HDAC3 were purchased from Sigma (Mission® esiRNA) and transfection was performed with Lipofectamine® RNAimax (Thermofisher) according to the manufacturer’s instructions. An in vitro tubulin polymerization assay kit (Merck) containing > 99% pure bovine tubulin was applied according to the manufacturer’s instructions. Spontaneous formation of microtubules in the presence of GTP at 37 °C was monitored by measuring the OD at 340 nm in an absorbance microplate reader over time. To measure the degree of intracellular tubulin polymerization by flow cytometry we performed tubulin staining under conditions where only polymerized tubulin is retained in the cells while tubulin monomers tend to get lost during the fixation procedure [54]. To this end, cells were fixed in 1 ml of 0.5% glutaraldehyde in microtubule-stabilizing buffer (80 mM Pipes [pH 6.8], 1 mM MgCl2, 5 mM EDTA, and 0.5% Triton X-100 [TX-100]). After 10 min, 0.7 ml NaBH4 (1 mg/ml in PBS) was added, and the cells were pelleted by centrifugation. Cells were then re-suspended in 20 μl of PBS containing 50 μg/ml RNase A, 0.2% TX-100, 2% bovine serum albumin [BSA], and 0.1% NaN3, and incubated overnight at 4 °C. After additional 3 h of incubation with an Alexa Fluor® 488 anti-Tubulin-α Antibody (clone 10D8; BioLegend), 200 μl of 50 μg/ml propidium iodide in PBS were added followed by flow cytometry. Median tubulin fluorescence was determined for the 4 N fraction.Lentiviral LSD1 knockdown and knockout
siRNA transfection
In vitro tubulin polymerization assay
Whole cell analysis of tubulin polymerization
Results
4SC-202 inhibits growth of CTCL cell lines at low micromolar concentrations
FK228 (romidepsin), which received FDA approval for the treatment of CTCL in 2009, has been described to inhibit the class I HDAC members, HDAC1, 2, and 3, at nanomolar levels while being less effective against HDACs 4, 6, 7, 8, and 9 [55, 56]. Similarly, albeit around one log less sensitive, the new orally available benzamide type HDAC inhibitor 4SC-202 is targeting the epigenetically important enzymes HDAC1–3 without affecting other HDAC enzymes at clinically relevant concentrations [57]. Importantly, however, 4SC-202 additionally inhibits a further epigenetic regulator, the lysine-specific demethylase 1 (LSD1) [43, 57], which in concert with HDAC1 and 2 mediates promoter silencing in particular as part of the multi-protein CoREST complex [21]. Because combined targeting of HDACs and LSD1 has been proposed to bear superior anti-cancer capabilities compared to sole HDAC inhibition [39], we started out to compare 4SC-202 with FK228 in six different CTCL cell lines by determining dose response curves. Cells were cultured for 72 h at two different cell densities before viability was analyzed by MTS assay. All CTCL cell lines showed a sharp drop in the MTS signal between 0.1 and 1 μM 4SC-202 while for peripheral blood lymphocytes (PBLs) and fibroblasts used as nonmalignant controls the curves declined over a broader range and were shifted towards higher concentrations (Fig. 1a red curves). Indeed, the calculated IC50 values for 4SC-202 were for almost all CTCL cell lines one order of magnitude lower compared to fibroblasts and PBLs (Fig. 1b and c). Interestingly, this unequal sensitivity was not associated with differential expression of the drug targets, since quantitative mRNA analysis revealed very similar expression levels for HDAC1, 3, and LSD1 in PBLs, fibroblasts. and CTCL cell lines while for HDAC2 the expression was generally much lower (Additional file 1: Figure S1). In case of FK228 treatment, we did not observe differences between CTCL cell lines and untransformed fibroblasts and PBLs (Fig. 1). Nevertheless, also FK228 effectively affected growth of the CTCL cell lines, and the absolute concentrations necessary for suppression of CTCL growth were much lower in case of FK228 compared to 4SC-202 (Fig. 1).
Only 4SC-202 induces an accumulation of cells in the G2/M phase of the cell cycle prior to death
To further explore how the two drugs affect the cells, we performed DNA staining following 4SC-202 and FK228 treatment. One day of incubation with 1 μM 4SC-202 induced an accumulation in the G2/M phase of the cell cycle in all six CTCL cell lines (Fig. 2). Moreover, 4SC-202-treated HuT 78 and HTB-176 cells presented already an increased sub-G1 fraction at this time point, and this dead cell population became the dominant fraction in all CTCL cell lines after 3 days of 4SC-202 treatment (Fig. 2). Similarly, 10 nM of FK228 induced extensive cell death in the CTCL cells evident by a predominant sub-G1-percentage after 72 h. In contrast to 4SC-202, however, this was not preceded by a G2/M arrest after 24 h of drug exposure (Fig. 2). DNA staining of untransformed control cells revealed weak (fibroblasts) to strong (PBL) cell death induction upon treatment with FK228 for 3 days. When these cells were treated with 1 μM 4SC-202, however, they neither displayed G2/M arrest nor cell death (Fig. 2). The control cells used in the MTS assay (Fig. 1), i.e., PBLs and a fibroblast preparation from adult skin (fibroblasts A), divide much slower than the CTCL cells. Hence, to exclude that, the absence of a 4SC-202-induced mitotic arrest is related to the division rate of the cells, we additionally analyzed foreskin fibroblasts (fibroblasts B), which proliferate comparably fast as most of the CTCL cell lines (Additional file 1: Table S1). Notably, also these fast dividing untransformed cells did not show any accumulation of cells in mitosis when analyzed after 24 h nor was prominent cell death induced upon treatment with 1 or 2 μM 4SC-202 (Fig. 2). In conclusion, 4SC-202 at 1 μM is strongly cytotoxic towards all analyzed CTCL cell lines but not towards untransformed control cells, and induced cell death is—in contrast to FK228—preceded by a G2/M arrest. To test whether 4SC-202 induces G2/M arrest also in other tumor cells, we treated cell lines from six further cancer entities with 2 μM 4SC-202. As depicted in Additional file 1: Figure S2, an accumulation of 4-N cells was evident in all tested cell lines derived from melanoma, Merkel cell carcinoma, breast cancer, lung adenocarcinoma, mantle cell lymphoma or osteosarcoma.
G2/M arrest and cell death induced by 4SC-202 is associated with only minor changes in acetylation and methylation of histone proteins in CTCL cell lines
We next addressed the question whether the differential response of CTCL cell lines towards the HDAC inhibitor FK228 and the combined HDAC/LSD1 inhibitor 4SC-202 might be due to differences in targeting HDACs and LSD1. To this end, we correlated the pattern of histone acetylation and methylation with the biological response towards the two compounds in two CTCL cell lines. Upon treatment of HTB-176 and CRL-2105 cells with increasing concentrations of 4SC-202 and FK228, we observed an increase in the sub-G1 fraction (Fig. 3a) accompanied by caspase-3 cleavage (Fig. 3b) and the appearance of early apoptotic cells (Annexin V+ 7AAD−) (Fig. 3a). However, only in the case of FK228, this was associated with a strong increase in acetylation of lysine 9 of histone 3 (H3K9ac) (Fig. 3b). Surprisingly, enhanced di-methylation of lysine 4 of histone 3 (H3K4me2) was also more pronounced in case of FK228 than in response to the designated LSD-1 inhibitor 4SC-202 at concentrations leading to comparable rates of cell death (Fig. 3a and b). As demonstrated before, a G2/M cell cycle arrest occurred only in the 4SC-202-treated cells (Fig. 3a).
Next, we analyzed whether higher concentrations of 4SC-202 could induce more pronounced histone acetylation and methylation in CTCL cells lines. Indeed, H3K9ac and H3K4me2 were strongly enhanced at 3, 10, or 30 μM 4SC-202 reaching levels comparable to FK228 in the three analyzed CTCL cell lines MyLa (Additional file 1: Fig. S3a), HTB-176, and CRL-2105 (Additional file 1: Fig. S4). In contrast, 1 μM 4SC-202, which already induces a full response with respect to G2/M arrest (Fig. 2), led to only very modest increases in both modifications (Additional file 1: Figs. S3a and S4). Interestingly, we observed in MyLa cells that 4SC-202 concentrations associated with strong changes in histone modifications induced even a less pronounced G2/M arrest (Additional file 1: Figs. S3b and c).
Compared to FK228 only minor changes in gene expression are induced by cytotoxic 4SC-202 concentrations
The proposed modus operandi of how epigenetic modifiers affect cancer cells is through changes in gene expression as a consequence of altered histone modification [14]. Since 4SC-202 could induce profound biological effects in CTCL cells without major changes in relevant histone modifications, we asked how respective drug concentrations would affect gene expression. To this end, we performed NanoString nCounter™ gene expression analyses [58] using an array allowing direct quantification of mRNAs coding for 519 different kinases and eight endogenous controls. In line with the observed differences in histone modification (Fig. 3b), 10 nM FK228 induced over twofold alterations in expression in 39 to 45% of the evaluable genes in the three analyzed cell lines (Fig. 4a and b). In contrast, in response to 0.25 μM 4SC-202—a concentration able to induce G2/M arrest (Additional file 1: Fig. S5) as well as profound cell death (Fig. 4c and Additional file 1: Fig. S5)—only 1–3% of the mRNAs showed either a reduction to less than 50% or a more than twofold increase (Fig. 4a and b). Notably, most of the mRNAs found to be induced more than twofold by 0.25 μM 4SC-202 were among the low expressed genes (less than 0.5% compared to GAPDH mRNA), thus, bearing a higher risk of being false positive. The only two induced genes with high expression levels were AURKA and PLK1 which, however, are both known to be increased during the G2/M phase [59, 60]. Hence, the observed increase may be a mere consequence of a prolonged G2/M phase in the 4SC-202 (0.25 μM)-treated cells rather than due to altered histone modification. Treatment with higher 4SC-202 concentrations (10 μM) led to gene expression changes comparable to FK228 (Fig. 4a and b) consistent with the profound alterations in H3K9ac and H3K4me2 (Additional file 1: Figs. S3a and S4).
The 4SC-202-induced G2/M arrest of CTCL cells is independent of de novo gene expression
The results so far suggested that the 4SC-202-mediated biological effects may occur independently from altered histone modifications and gene expression. To further test whether the capacity of this compound to arrest cells in the G2/M phase of the cell cycle is dependent on gene induction, we used the potent transcription inhibitor actinomycin D, which at 1 μg/ml, is completely blocking mRNA expression ([61]; Additional file 1: Figure S6a). Notably, the progress from G2/M to G1 is independent of transcription since upon release from a nocodazole-induced G2/M arrest, cells proceed to G1 irrespective of the presence of actinomycin D (Fig. 5d and Additional file 1: Figure S5 and S7). Incubation with 4SC-202, however, sustained the nocodazole-induced G2/M arrest both in the absence as well as in the presence of actinomycin D in CTCL cell lines (Fig. 5d and Additional file 1: Fig. S7a and b) and in 293 T cells (Additional file 1: Figure S6b and c). These findings indicate that 4SC-202 is able to arrest cells in G2/M without inducing gene expression. Nocodazole activates the spindle assembly checkpoint and arrests cells in prometaphase [62]. Hence, since 4SC-202 is able to maintain the nocodazole-induced G2/M arrest, 4SC-202 has to exert its function at the same point or later in mitosis. In addition, since even complete repression of transcription by actinomycin D in these cell cycle phases does not prevent the transition from prometaphase to G1, it can be concluded that for maintenance of the G2/M, arrest by 4SC-202 also gene repression is not required.
The 4SC-202-induced G2/M arrest is independent of LSD1
Based on the inhibitory features described for FK228 [55, 56] and 4SC-202 [57], and the observation that combined siRNA-mediated knockdown of HDAC1 and HDAC3 did not induce a G2/M arrest (Additional file 1: Figure S8), the most likely explanation for the differential cellular responses induced by the two compounds would be the additional targeting of LSD1 by 4SC-202. However, as described above, our results did not suggest that the G2/M arrest induced by 4SC-202 is due to targeting a transcriptional repressor. Nevertheless, because only indirect evidence argued against LSD1 and due to the versatile functions of LSD1, which can act also as a transcriptional activator [22,23,24] or may modulate also the function of non-histone proteins [26], LSD1 could not be definitely ruled out as the critical target for the 4SC-202-induced G2/M arrest. Therefore, to explore further a possible role of LSD1 as 4SC-202 target, we used a Doxycyclin (Dox)-inducible shRNA targeting LSD1 to knockdown LSD1 in MyLa cells (Fig. 5a). Dox-induced reduction of LSD1 expression was neither associated with a change in cell cycle distribution of untreated cells nor was the G2/M arrest upon 4SC-202 treatment affected by reduced LSD1 levels (Fig. 5b and c). Both results argue against LSD1 being the target mediating this 4SC-202 effect.
To exclude that the residual LSD1 expression after knockdown (Fig. 5a) was still too high to significantly interfere with its function, we aimed to knockout LSD1 by CRISPR/Cas9. Due to the relatively poor infectibility of the CTCL cell lines, we did not succeed to establish CTCL cells completely devoid of LSD1 expression. Therefore, we used the cervix carcinoma cell line HeLa as the model system, which like CTCL cells undergoes G2/M arrest followed by cell death upon treatment with 4SC-202 (Additional file 1: Figure S9). Two HeLa single-cell clones completely lacking LSD1 expression were established (Fig. 5d). As in MyLa LSD1-knockdown cells, neither cell cycle distribution of untreated cells nor the G2/M arrest upon 4SC-202 treatment was affected by the absence of LSD1. Further analysis of the Sub-G1 population after 72 h demonstrated that also the induction of cell death by 4SC-202 is not affected by knockdown or knockout of LSD1 (Additional file 1: Figure S10). Thus, functional inactivation of LSD1 by 4SC-202 is neither sufficient nor required for the observed biological effects.
Enforced expression of HDAC1 counteracts the effect of FK228 but not of 4SC-202
Recently, targeting of class I HDACs by 4SC-202 has been proposed as the critical mechanism for inhibiting oncogenic signaling and proliferation in medulloblastoma cells [63]. To further sustain our results arguing against the involvement of HDAC for 4SC-202 activity in CTCL cell lines, we aimed to directly test the impact of class I HDACs on the response towards 4SC-202 and investigated for comparison also the class I HDAC inhibitor FK228. Real time PCR analysis had demonstrated that out of the HDACs targeted by both drugs, HDAC1 and 3 are predominant in CTCL cells (Additional file 1: Figure S1). We, therefore, applied the CRISPR/Cas9 synergistic activation mediator (SAM) system [64] to further increase expression of HDAC1, HDAC3, and for control purposes LSD1 in MyLa cells (Fig. 5g and Additional file 1: Figure S11a and b). In line with class I HDACs being the critical targets, cell death induced by 2 nM FK228 was significantly reduced in MyLa cells expressing elevated levels of HDAC1 (Fig. 5h). In contrast, no reduction of induced cell death was observed in case of treatment with 0.3 μM 4SC-202 (Fig. 5h).
4SC-202 induces major defects in the process of mitosis
All results so far argued for 4SC-202 targeting molecules beyond HDACs and LSD1, and the most obvious biological difference compared to FK228 was the induction of a G2/M arrest. To determine how 4SC-202 affects mitosis, we applied time-lapse microscopy. Because this is not feasible with CTCL cells, which are growing as spheroids in suspension, we used again HeLa cells as the model system. To facilitate time-lapse microscopic observation of mitosis, we used HeLa cells expressing a green fluorescent H2B-GFP fusion protein. Normal cell division in untreated control cells was accomplished within 1 h (Fig. 6a). In the presence of 4SC-202, however, this process was significantly disturbed: cells detached and rounded up normally at the onset of mitosis but in contrast to control cells remained in this state for 8.8 h on average (Fig. 6a and c). The delayed detachment phase was then ceased by an aberrant cell division. In 37% of the quantified cells, no nuclear division occurred, and cells settled down again without having divided (Fig. 6a and b). Lack of abscission and generation of di-nuclear cells manifested in more than 40% while cell death directly following aberrant mitosis was observed in 17% of the analyzed cells (Fig. 6b). In contrast to these major defects in mitosis conveyed by 4SC-202 treatment, FK228 applied at different concentrations resulted in only a slight delay of the mitotic process (Fig. 6b) and in only slightly increased failure of cytokinesis or abscission (Fig. 6c).
4SC-202 inhibits tubulin polymerization
To further visualize the mitotic perturbations induced by 4SC-202, we made use of H2B-GFP HeLa cells additionally expressing tubulin-RFP. Here, it became evident that condensation of the chromosomes and breakdown of the nuclear lamina (evident by tubulin being evenly distributed throughout the cell) occurred normally in the 4SC-202-treated cells (Fig. 6d). Formation of the mitotic spindle, however, and subsequent formation of metaphase plate were impaired (Fig. 6d) suggesting that 4SC-202 directly or indirectly might act as a “spindle poison”. To test whether 4SC-202 is directly affecting tubulin polymerization, we applied an in vitro tubulin polymerization assay, which allows assessing polymer formation in a tubulin solution by monitoring the OD at 340 nm over time. While paclitaxel, a molecule known to stabilize microtubules, accelerated the process, 4SC-202, like nocodazole—a known inhibitor of tubulin polymerization—decreased the polymerization rate (Fig. 6e). In contrast, FK228 did not affect in vitro microtubule formation. To confirm that 4SC-202 affects also intracellular tubulin polymerization, we applied an assay allowing quantification of intracellular tubulin polymers [54]. Indeed, we could demonstrate in HeLa, as well as in two CTCL cell lines (HTB-176 and CRL-2105) that 4SC-202 reduces intracellular polymerized tubulin to a similar degree as nocodazole (Additional file 1: Fig. S12a). In a second set of experiments, we exploited the fact that activation of the spindle assembly checkpoint (SAC) is essential for mitotic arrest induced by drugs affecting spindle formation [65]. The key SAC activating kinase is monopolar spindle 1 (MPS1), and a characteristic feature of a microtubule defect-induced cell cycle arrest is that it can be overcome by inhibiting MPS1 [66, 67]. Indeed, the specific MPS1-inhibitor BAY1217389 induces in cells arrested by nocodazole as well as by 4SC-202 a premature exit from mitosis, as indicated by a reduction of Cyclin B1 expression and reattachment of detached cells (Additional file 1: Fig. S12b and c).
Discussion
Recent pre-clinical studies on 4SC-202 have demonstrated activity against hepatocellular carcinoma [68], colorectal cancer [69], urothelial carcinoma [57], medulloblastoma [63, 70], and pancreatic cancer cells [71]. Our study adds cutaneous T cell lymphoma to this list. Moreover, in line with previous publications [69, 70], we observed that cytotoxicity induced by 4SC-202 was elevated in cancer cells compared to untransformed control cells.
Interestingly, different mechanisms have been proposed for how 4SC-202 would inhibit cellular growth and viability. In this respect, activation of the ASK1-dependent mitochondrial apoptosis pathway in hepatocellular carcinoma cells [68], inhibition of hedgehog/GLI signaling in medulloblastoma cells [63], or increased expression of BRD4- and MYC-dependent epithelial genes in pancreatic cancer cells [71] have been suggested as critical anti-tumorigenic outcome following inhibition of its primary targets by 4SC-202. Indeed, all previous studies on 4SC-202 have in common that the authors either assume or provide evidence that these primary targets are class I HDACs and/or LSD1. In contrast, our results suggest that 4SC-202 has the potential to inhibit cancer cell growth also independent of targeting these epigenetic modifiers, and independent of altering cellular transcription.
Our study on CTCL cells was largely based on the comparison of 4SC-202 with FK228, a class I HDAC inhibitor approved in the US for the treatment of CTCL [72, 73]. One major difference regarding the biological effects induced by the two inhibitors was that cell death induction by 4SC-202 was preceded by a G2/M arrest, a feature of 4SC-202 reported by others as well [57, 69]. Since HDACs1–3 are also inhibited by FK228 [55, 56], the only other described target of 4SC-202, i.e., LSD-1, [43] seemed to be the best candidate to mediate the observed G2/M arrest. However, neither knockdown nor knockout of LSD-1 affected cell cycle distribution of untreated or 4SC-202-treated cells. Furthermore, and in contrast to FK228, 4SC-202-induced cytotoxicity could not be attenuated by HDAC1 overexpression, and was observed already at concentrations associated with only minor changes in histone modifications and gene transcription. Finally, even under conditions of completely abolished cellular transcription, 4SC-202 could maintain a G2/M arrest. Together, these results suggest that 4SC-202 can induce mitotic arrest and cell death by targeting molecules which differ from its targets described so far. Our data, however, do not suggest that 4SC-202 cannot inhibit HDACs and LSD-1 in CTCL or other cells. Nevertheless, it is of interest that a recent publication raised doubts whether 4SC-202 would target LSD1 at all [40].
The major structural elements of the mitotic spindle are microtubule polymers consisting of α/β tubulin heterodimers. [74] Spindle assembly as well as chromosome segregation during mitosis are highly complex processes involving multiple accessory proteins [74, 75]. Nevertheless, spindle formation and function are based on the fundamental capability of tubulin to undergo spontaneous microtubule polymerization in the presence of GTP [76]. Disturbing microtubule polymerization has proven efficacy in the clinic against a broad range of malignancies [77], and respective antimitotic drugs are usually classified as either microtubule-destabilizing agents, which inhibit microtubule polymerization (e.g., nocodazole) or microtubule-stabilizing agents (e.g., paclitaxel) [74]. In a very simple in vitro system consisting of highly purified α- and β-tubulin and GTP, we demonstrated here that 4SC-202 is able to inhibit tubulin polymerization just like nocodazole suggesting that it might act as a microtubule-destabilizing spindle poison. Indeed, using time-lapse microscopy, we could confirm that 4SC-202 is able to inhibit formation of the mitotic spindle in HeLa cells. Since 4SC-202-treated CTCL cells display a reduction of polymerized tubulin in 4-N cells as well as activation of the spindle assembly checkpoint, it is very likely that also in CTCL cells 4SC-202 is affecting formation of the mitotic spindle and thereby induces the observed G2/M arrest. Furthermore, since a 4SC-202-induced mitotic arrest has been described for colorectal cancer [69] and urothelial carcinoma cells [57], and we observed the same in six out of six cell lines from further cancer entities, targeting of tubulin polymerization might be a general mechanism contributing to impairment of tumor cells by 4SC-202. This probably includes also cytotoxic effects induced by 4SC-202 since it is well known that inhibiting mitosis finally leads to cell death [77]. Because it is indicating a potentially large therapeutic window, it is of special interest that arrest and cell death induced by 4SC-202 occurred only in cancer cells. Indeed, even fast-proliferating control cells were barely affected by 4SC-202 treatment. Since it has been shown that modifying microtubule stability can change the sensitivity towards nocodazole [78], a possible explanation for the differential sensitivity towards 4SC-202 might be diverse microtubule stability in cancer and control cells.
Emerging therapies for leukemia and lymphoma are frequently based on the application of epigenetic modifiers and especially HDAC inhibitors [79,80,81]. Our data suggest that in contrast to most other HDAC inhibitors, 4SC-202 is additionally directly targeting microtubule formation. Polypharmacology, a concept encompassing both, multiple drugs binding different targets as well as one drug binding multiple targets within a pathological network, is considered as a very useful strategy for the treatment of complex and refractory diseases, in particular of cancer [82]. In this respect, attempts have been made to design new drugs targeting HDACs as well as tubulin polymerization, and recently such compounds demonstrating excellent anti-proliferative activity have been described [83]. Furthermore, mocetinostat, an inhibitor of class I/IV HDACs which is currently under clinical evaluation [84], has been demonstrated to also bear microtubule inhibitory activity although direct interaction with tubulin was not formally proven [85]. Notably, HDAC inhibitors can disrupt mitosis by affecting a number of components of the mitotic machinery [86]. Our results, however, argue against such an indirect effect. Indeed, here we describe that 4SC-202, which so far was considered as a drug targeting class I HDACs as well as the histone demethylase LSD1, is also a potent microtubule-destabilizing agent. The latter function was dominant for the impairment of CTCL cell lines in our in vitro experiments. This, however, does not exclude a contribution of the other inhibitory features to the anti-tumoral activity of the substance. This holds true for direct effects on cancer cells but even more for indirect effects, which cannot be detected in vitro. In this respect, it is intriguing that very recently LSD1 was demonstrated to be critical for inhibiting tumor cell immunogenicity [87]. Furthermore, also HDAC inhibitors are discussed as potential immunomodulating agents to treat cancer [88]. Therefore, it will be interesting to evaluate whether the pleiotropic molecular features of 4SC-202 may turn into benefits for treated cancer patients. In this respect, a first-in-man phase I clinical trial with 4SC-202 (www.clinicaltrials.gov, NCT01344707) for patients with advanced hematological malignancies has been launched [44] and a report of the results is awaited soon.
Conclusions
We provide pre-clinical in vitro data that cutaneous T cell lymphoma cells are specifically sensitive towards 4SC-202, a compound previously described as a dual inhibitor targeting type I HDACs as well as LSD1. However, our experiments suggest that 4SC-202-induced G2/M arrest and cell death is not due to targeting these epigenetic modifiers, but that 4SC-202 has a further molecular function by directly inhibiting tubulin polymerization.
Abbreviations
- CTCL:
-
Cutaneous T cell lymphoma
- HDAC:
-
Histone deacetylase
- LSD1:
-
Lysine-specific demethylase 1
References
Chung CG, Poligone B. Cutaneous T cell lymphoma: an update on pathogenesis and systemic therapy. Curr Hematol Malig Rep. 2015;10(4):468–76.
Choi J, Goh G, Walradt T, Hong BS, Bunick CG, Chen K, Bjornson RD, Maman Y, Wang T, Tordoff J, et al. Genomic landscape of cutaneous T cell lymphoma. Nat Genet. 2015;47(9):1011–9.
Humme D, Nast A, Erdmann R, Vandersee S, Beyer M. Systematic review of combination therapies for mycosis fungoides. Cancer Treat Rev. 2014;40(8):927–33.
Weberschock T, Strametz R, Lorenz M, Rollig C, Bunch C, Bauer A, Schmitt J. Interventions for mycosis fungoides. Cochrane Database Syst Rev. 2012;9:CD008946.
Schlaak M, Pickenhain J, Theurich S, Skoetz N, von Bergwelt-Baildon M, Kurschat P. Allogeneic stem cell transplantation versus conventional therapy for advanced primary cutaneous T-cell lymphoma. Cochrane Database Syst Rev. 2013;8:CD008908.
Ungewickell A, Bhaduri A, Rios E, Reuter J, Lee CS, Mah A, Zehnder A, Ohgami R, Kulkarni S, Armstrong R, et al. Genomic analysis of mycosis fungoides and Sezary syndrome identifies recurrent alterations in TNFR2. Nat Genet. 2015;47(9):1056–60.
Wang L, Ni X, Covington KR, Yang BY, Shiu J, Zhang X, ** L, Meng Q, Langridge T, Drummond J, et al. Genomic profiling of Sezary syndrome identifies alterations of key T cell signaling and differentiation genes. Nat Genet. 2015;47(12):1426–34.
McGirt LY, Jia P, Baerenwald DA, Duszynski RJ, Dahlman KB, Zic JA, Zwerner JP, Hucks D, Dave U, Zhao Z, et al. Whole-genome sequencing reveals oncogenic mutations in mycosis fungoides. Blood. 2015;126(4):508–19.
Scarisbrick JJ, Woolford AJ, Calonje E, Photiou A, Ferreira S, Orchard G, Russell-Jones R, Whittaker SJ. Frequent abnormalities of the p15 and p16 genes in mycosis fungoides and sezary syndrome. J Invest Dermatol. 2002;118(3):493–9.
Navas IC, Algara P, Mateo M, Martinez P, Garcia C, Rodriguez JL, Vanaclocha F, Barrientos N, Iglesias L, Sanchez L, et al. p16(INK4a) is selectively silenced in the tumoral progression of mycosis fungoides. Lab Investig. 2002;82(2):123–32.
Marquard L, Poulsen CB, Gjerdrum LM, de Nully BP, Christensen IJ, Jensen PB, Sehested M, Johansen P, Ralfkiaer E. Histone deacetylase 1, 2, 6 and acetylated histone H4 in B- and T-cell lymphomas. Histopathology. 2009;54(6):688–98.
Marquard L, Gjerdrum LM, Christensen IJ, Jensen PB, Sehested M, Ralfkiaer E. Prognostic significance of the therapeutic targets histone deacetylase 1, 2, 6 and acetylated histone H4 in cutaneous T-cell lymphoma. Histopathology. 2008;53(3):267–77.
Gloghini A, Buglio D, Khaskhely NM, Georgakis G, Orlowski RZ, Neelapu SS, Carbone A, Younes A. Expression of histone deacetylases in lymphoma: implication for the development of selective inhibitors. Br J Haematol. 2009;147(4):515–25.
Rasheed WK, Johnstone RW, Prince HM. Histone deacetylase inhibitors in cancer therapy. Expert Opin Investig Drugs. 2007;16(5):659–78.
Mann BS, Johnson JR, Cohen MH, Justice R, Pazdur R. FDA approval summary: vorinostat for treatment of advanced primary cutaneous T-cell lymphoma. Oncologist. 2007;12(10):1247–52.
StatBite: FDA oncology drug product approvals in 2009. J Natl Cancer Inst. 2010;102(4):219.
Zhou VW, Goren A, Bernstein BE. Charting histone modifications and the functional organization of mammalian genomes. Nat Rev Genet. 2011;12(1):7–18.
Pekowska A, Benoukraf T, Zacarias-Cabeza J, Belhocine M, Koch F, Holota H, Imbert J, Andrau JC, Ferrier P, Spicuglia S. H3K4 tri-methylation provides an epigenetic signature of active enhancers. EMBO J. 2011;30(20):4198–210.
Morera L, Lubbert M, Jung M. Targeting histone methyltransferases and demethylases in clinical trials for cancer therapy. Clin Epigenetics. 2016;8:57.
Shi Y, Lan F, Matson C, Mulligan P, Whetstine JR, Cole PA, Casero RA, Shi Y. Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell. 2004;119(7):941–53.
Ooi L, Wood IC. Chromatin crosstalk in development and disease: lessons from REST. Nat Rev Genet. 2007;8(7):544–54.
Metzger E, Wissmann M, Yin N, Muller JM, Schneider R, Peters AH, Gunther T, Buettner R, Schule R. LSD1 demethylates repressive histone marks to promote androgen-receptor-dependent transcription. Nature. 2005;437(7057):436–9.
Wissmann M, Yin N, Muller JM, Greschik H, Fodor BD, Jenuwein T, Vogler C, Schneider R, Gunther T, Buettner R, et al. Cooperative demethylation by JMJD2C and LSD1 promotes androgen receptor-dependent gene expression. Nat Cell Biol. 2007;9(3):347–53.
He Y, Zhao Y, Wang L, Bohrer LR, Pan Y, Wang L, Huang H. LSD1 promotes S-phase entry and tumorigenesis via chromatin co-occupation with E2F1 and selective H3K9 demethylation. Oncogene. 2018;37(4):534–43.
Laurent B, Ruitu L, Murn J, Hempel K, Ferrao R, **ang Y, Liu S, Garcia BA, Wu H, Wu F, et al. A specific LSD1/KDM1A isoform regulates neuronal differentiation through H3K9 demethylation. Mol Cell. 2015;57(6):957–70.
Huang J, Sengupta R, Espejo AB, Lee MG, Dorsey JA, Richter M, Opravil S, Shiekhattar R, Bedford MT, Jenuwein T, et al. p53 is regulated by the lysine demethylase LSD1. Nature. 2007;449(7158):105–8.
Lim S, Janzer A, Becker A, Zimmer A, Schule R, Buettner R, Kirfel J. Lysine-specific demethylase 1 (LSD1) is highly expressed in ER-negative breast cancers and a biomarker predicting aggressive biology. Carcinogenesis. 2010;31(3):512–20.
Boulding T, McCuaig RD, Tan A, Hardy K, Wu F, Dunn J, Kalimutho M, Sutton CR, Forwood JK, Bert AG, et al. LSD1 activation promotes inducible EMT programs and modulates the tumour microenvironment in breast cancer. Sci Rep. 2018;8(1):73.
Amente S, Lania L, Majello B. The histone LSD1 demethylase in stemness and cancer transcription programs. Biochim Biophys Acta. 2013;1829(10):981–6.
Amente S, Milazzo G, Sorrentino MC, Ambrosio S, Di Palo G, Lania L, Perini G, Majello B. Lysine-specific demethylase (LSD1/KDM1A) and MYCN cooperatively repress tumor suppressor genes in neuroblastoma. Oncotarget. 2015;6(16):14572–83.
Hayami S, Kelly JD, Cho HS, Yoshimatsu M, Unoki M, Tsunoda T, Field HI, Neal DE, Yamaue H, Ponder BA, et al. Overexpression of LSD1 contributes to human carcinogenesis through chromatin regulation in various cancers. Int J Cancer. 2011;128(3):574–86.
Lv T, Yuan D, Miao X, Lv Y, Zhan P, Shen X, Song Y. Over-expression of LSD1 promotes proliferation, migration and invasion in non-small cell lung cancer. PLoS One. 2012;7(4):e35065.
Hojfeldt JW, Agger K, Helin K. Histone lysine demethylases as targets for anticancer therapy. Nat Rev Drug Discov. 2013;12(12):917–30.
Maiques-Diaz A, Somervaille TC. LSD1: biologic roles and therapeutic targeting. Epigenomics. 2016;8(8):1103–16.
Hino S, Kohrogi K, Nakao M. Histone demethylase LSD1 controls the phenotypic plasticity of cancer cells. Cancer Sci. 2016;107(9):1187–92.
Ueda R, Suzuki T, Mino K, Tsumoto H, Nakagawa H, Hasegawa M, Sasaki R, Mizukami T, Miyata N. Identification of cell-active lysine specific demethylase 1-selective inhibitors. J Am Chem Soc. 2009;131(48):17536–7.
Maes T, Mascaro C, Tirapu I, Estiarte A, Ciceri F, Lunardi S, Guibourt N, Perdones A, Lufino MMP, Somervaille TCP, et al. ORY-1001, a potent and selective covalent KDM1A inhibitor, for the treatment of acute leukemia. Cancer Cell. 2018;33(3):495–511 e412.
Takagi S, Ishikawa Y, Mizutani A, Iwasaki S, Matsumoto S, Kamada Y, Nomura T, Nakamura K. LSD1 inhibitor T-3775440 inhibits SCLC cell proliferation by disrupting LSD1 interactions with SNAG domain proteins INSM1 and GFI1B. Cancer Res. 2017;77(17):4652–62.
Duan YC, Ma YC, Qin WP, Ding LN, Zheng YC, Zhu YL, Zhai XY, Yang J, Ma CY, Guan YY. Design and synthesis of tranylcypromine derivatives as novel LSD1/HDACs dual inhibitors for cancer treatment. Eur J Med Chem. 2017;140:392–402.
Kalin JH, Wu M, Gomez AV, Song Y, Das J, Hayward D, Adejola N, Wu M, Panova I, Chung HJ, et al. Targeting the CoREST complex with dual histone deacetylase and demethylase inhibitors. Nat Commun. 2018;9(1):53.
Haydn T, Metzger E, Schuele R, Fulda S. Concomitant epigenetic targeting of LSD1 and HDAC synergistically induces mitochondrial apoptosis in rhabdomyosarcoma cells. Cell Death Dis. 2017;8(6):e2879.
Milelli A, Marchetti C, Turrini E, Catanzaro E, Mazzone R, Tomaselli D, Fimognari C, Tumiatti V, Minarini A. Novel polyamine-based histone deacetylases-lysine demethylase 1 dual binding inhibitors. Bioorg Med Chem Lett. 2018;28(6):1001–4.
Inui K, Zhao Z, Yuan J, Jayaprakash S, Le LTM, Drakulic S, Sander B, Golas MM. Stepwise assembly of functional C-terminal REST/NRSF transcriptional repressor complexes as a drug target. Protein Sci. 2017;26(5):997–1011.
von Tresckow B, Gundermann S, Eichenauer DA, Aulitzky WA, Goebeler M, Sayehli C, Bacchus L, Hauns B, Mais A, Hentsch B, et al. First-in-human study of 4SC-202, a novel oral HDAC inhibitor in advanced hematologic malignancies (TOPAS study). J Clin Oncol Off J Am Soc Clin Oncol. 2014;32(32:5s):abstr 8559.
Starkebaum G, Loughran TP Jr, Waters CA, Ruscetti FW. Establishment of an IL-2 independent, human T-cell line possessing only the p70 IL-2 receptor. Int J Cancer. 1991;49(2):246–53.
Mitsuya H, Matis LA, Megson M, Bunn PA, Murray C, Mann DL, Gallo RC, Broder S. Generation of an HLA-restricted cytotoxic T cell line reactive against cultured tumor cells from a patient infected with human T cell leukemia/lymphoma virus. J Exp Med. 1983;158(3):994–9.
Mann DL, O'Brien SJ, Gilbert DA, Reid Y, Popovic M, Read-Connole E, Gallo RC, Gazdar AF. Origin of the HIV-susceptible human CD4+ cell line H9. AIDS Res Hum Retrovir. 1989;5(3):253–5.
Gazdar AF, Carney DN, Bunn PA, Russell EK, Jaffe ES, Schechter GP, Guccion JG. Mitogen requirements for the in vitro propagation of cutaneous T-cell lymphomas. Blood. 1980;55(3):409–17.
Krejsgaard T, Vetter-Kauczok CS, Woetmann A, Lovato P, Labuda T, Eriksen KW, Zhang Q, Becker JC, Odum N. Jak3- and JNK-dependent vascular endothelial growth factor expression in cutaneous T-cell lymphoma. Leukemia. 2006;20(10):1759–66.
Kaltoft K, Bisballe S, Rasmussen HF, Thestrup-Pedersen K, Thomsen K, Sterry W. A continuous T-cell line from a patient with Sezary syndrome. Arch Dermatol Res. 1987;279(5):293–8.
Houben R, Adam C, Baeurle A, Hesbacher S, Grimm J, Angermeyer S, Henzel K, Hauser S, Elling R, Brocker EB, et al. An intact retinoblastoma protein-binding site in Merkel cell polyomavirus large T antigen is required for promoting growth of Merkel cell carcinoma cells. IntJ Cancer. 2012;130(4):847–56.
Angermeyer S, Hesbacher S, Becker JC, Schrama D, Houben R. Merkel cell polyomavirus-positive Merkel cell carcinoma cells do not require expression of the viral small T antigen. J Invest Dermatol. 2013;133(8):2059–64.
Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11(8):783–4.
Morrison KC, Hergenrother PJ. Whole cell microtubule analysis by flow cytometry. Anal Biochem. 2012;420(1):26–32.
Furumai R, Matsuyama A, Kobashi N, Lee KH, Nishiyama M, Nakajima H, Tanaka A, Komatsu Y, Nishino N, Yoshida M, et al. FK228 (depsipeptide) as a natural prodrug that inhibits class I histone deacetylases. Cancer Res. 2002;62(17):4916–21.
Wang C, Henkes LM, Doughty LB, He M, Wang D, Meyer-Almes FJ, Cheng YQ. Thailandepsins: bacterial products with potent histone deacetylase inhibitory activities and broad-spectrum antiproliferative activities. J Nat Prod. 2011;74(10):2031–8.
Pinkerneil M, Hoffmann MJ, Kohlhof H, Schulz WA, Niegisch G. Evaluation of the therapeutic potential of the novel isotype specific HDAC inhibitor 4SC-202 in urothelial carcinoma cell lines. Target Oncol. 2016;11(6):783–98.
Geiss GK, Bumgarner RE, Birditt B, Dahl T, Dowidar N, Dunaway DL, Fell HP, Ferree S, George RD, Grogan T, et al. Direct multiplexed measurement of gene expression with color-coded probe pairs. Nat Biotechnol. 2008;26(3):317–25.
van Vugt MA, Medema RH. Getting in and out of mitosis with polo-like kinase-1. Oncogene. 2005;24(17):2844–59.
Tanaka M, Ueda A, Kanamori H, Ideguchi H, Yang J, Kitajima S, Ishigatsubo Y. Cell-cycle-dependent regulation of human aurora a transcription is mediated by periodic repression of E4TF1. J Biol Chem. 2002;277(12):10719–26.
Bensaude O. Inhibiting eukaryotic transcription: which compound to choose? How to evaluate its activity? Transcription. 2011;2(3):103–8.
Jemaa M, Manic G, Vitale I. Synchronization and desynchronization of cells by interventions on the spindle assembly checkpoint. Methods Mol Biol. 2017;1524:77–95.
Gruber W, Peer E, Elmer DP, Sternberg C, Tesanovic S, Del Burgo P, Coni S, Canettieri G, Neureiter D, Bartz R, et al. Targeting class I histone deacetylases by the novel small molecule inhibitor 4SC-202 blocks oncogenic hedgehog-GLI signaling and overcomes smoothened inhibitor resistance. Int J Cancer. 2018;142(5):968–75.
Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 2015;517(7536):583–8.
Musacchio A, Salmon ED. The spindle-assembly checkpoint in space and time. Nat Rev Mol Cell Biol. 2007;8(5):379–93.
Wengner AM, Siemeister G, Koppitz M, Schulze V, Kosemund D, Klar U, Stoeckigt D, Neuhaus R, Lienau P, Bader B, et al. Novel Mps1 kinase inhibitors with potent antitumor activity. Mol Cancer Ther. 2016;15(4):583–92.
Schmidt M, Budirahardja Y, Klompmaker R, Medema RH. Ablation of the spindle assembly checkpoint by a compound targeting Mps1. EMBO Rep. 2005;6(9):866–72.
Fu M, Wan F, Li Z, Zhang F. 4SC-202 activates ASK1-dependent mitochondrial apoptosis pathway to inhibit hepatocellular carcinoma cells. Biochem Biophys Res Commun. 2016;471(2):267–73.
Zhijun H, Shusheng W, Han M, Jian** L, Li-Sen Q, Dechun L. Pre-clinical characterization of 4SC-202, a novel class I HDAC inhibitor, against colorectal cancer cells. Tumour Biol. 2016;37(8):10257–67.
Messerli SM, Hoffman MM, Gnimpieba EZ, Kohlhof H, Bhardwaj RD: 4SC-202 as a potential treatment for the pediatric brain tumor medulloblastoma. Brain Sci 2017;7(11):147.
Mishra VK, Wegwitz F, Kosinsky RL, Sen M, Baumgartner R, Wulff T, Siveke JT, Schildhaus HU, Najafova Z, Kari V, et al. Histone deacetylase class-I inhibition promotes epithelial gene expression in pancreatic cancer cells in a BRD4- and MYC-dependent manner. Nucleic Acids Res. 2017;45(11):6334–49.
Harrison SJ, Bishton M, Bates SE, Grant S, Piekarz RL, Johnstone RW, Dai Y, Lee B, Araujo ME, Prince HM. A focus on the preclinical development and clinical status of the histone deacetylase inhibitor, romidepsin (depsipeptide, Istodax®). Epigenomics. 2012;4(5):571–89.
Prince HM, Dickinson M, Khot A. Romidepsin for cutaneous T-cell lymphoma. Future Oncol. 2013;9(12):1819–27.
Nogales E. Structural insights into microtubule function. Annu Rev Biochem. 2000;69:277–302.
Jordan MA, Wilson L. Microtubules as a target for anticancer drugs. Nat Rev Cancer. 2004;4(4):253–65.
Weisenberg RC. Microtubule formation in vitro in solutions containing low calcium concentrations. Science. 1972;177(4054):1104–5.
Manchado E, Guillamot M, Malumbres M. Killing cells by targeting mitosis. Cell Death Differ. 2012;19(3):369–77.
Wu J, He Z, Wang DL, Sun FL. Depletion of JMJD5 sensitizes tumor cells to microtubule-destabilizing agents by altering microtubule stability. Cell Cycle. 2016;15(21):2980–91.
Saygin C, Carraway HE. Emerging therapies for acute myeloid leukemia. J Hematol Oncol. 2017;10(1):93.
Lopez AT, Bates S, Geskin L. Current status of HDAC inhibitors in cutaneous T-cell lymphoma. Am J Clin Dermatol. 2018;19(6):805–19.
Eckschlager T, Plch J, Stiborova M, Hrabeta J. Histone deacetylase inhibitors as anticancer drugs. Int J Mol Sci. 2017;18(7):1414.
Boran AD, Iyengar R. Systems approaches to polypharmacology and drug discovery. Curr Opin Drug Discov Devel. 2010;13(3):297–309.
Lamaa D, Lin HP, Zig L, Bauvais C, Bollot G, Bignon J, Levaique H, Pamlard O, Dubois J, Ouaissi M, et al. Design and synthesis of tubulin and histone deacetylase inhibitor based on iso-Combretastatin A-4. J Med Chem. 2018;61(15):6574–6591.
Chan E, Chiorean EG, O'Dwyer PJ, Gabrail NY, Alcindor T, Potvin D, Chao R, Hurwitz H. Phase I/II study of mocetinostat in combination with gemcitabine for patients with advanced pancreatic cancer and other advanced solid tumors. Cancer Chemother Pharmacol. 2018;81(2):355–64.
Chia K, Beamish H, Jafferi K, Gabrielli B. The histone deacetylase inhibitor MGCD0103 has both deacetylase and microtubule inhibitory activity. Mol Pharmacol. 2010;78(3):436–43.
Gabrielli B, Chia K, Warrener R. Finally, how histone deacetylase inhibitors disrupt mitosis! Cell Cycle. 2011;10(16):2658–61.
Sheng W, LaFleur MW, Nguyen TH, Chen S, Chakravarthy A, Conway JR, Li Y, Chen H, Yang H, Hsu PH, et al. LSD1 ablation stimulates anti-tumor immunity and enables checkpoint blockade. Cell. 2018;174(3):549–63 e519.
Conte M, De Palma R, Altucci L. HDAC inhibitors as epigenetic regulators for cancer immunotherapy. Int J Biochem Cell Biol. 2018;98:65–74.
Acknowledgements
We thank Lena Neuß and Eva-Maria Sarosi for excellent technical assistance.
Funding
The study was partially financed by a LEO Foundation Award granted to David Schrama. This publication was funded by the German Research Foundation (DFG) and the University of Wuerzburg in the funding programme Open Access Publishing.
Availability of data and materials
The data generated or analyzed during this study are included in the published article and its supplementary files.
Author information
Authors and Affiliations
Contributions
MW, DS, and RH designed the study, supervised experiments and data acquisition, and wrote the manuscript. RH, AW, AG, ST, KS, TB, and SH performed experiments and analyzed data. MG, RB, and HK contributed to the conception, writing, and final approval of the work to be published. All atuhors read and approved the final manuscript.
Corresponding author
Ethics declarations
Authors’ information
Not applicable.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The study was performed at the dermatology department in Würzburg. The 4SC AG, which develops small molecule inhibitors for cancer therapy, provided reagents and covered costs for selected consumables for this study. Rene Bartz is and Hella Kohlhof has been a former employee of 4SC AG. The other authors declare that they have no competing interests.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Additional file
Additional file 1:
Table S1. Doubling time in hours of the investigated cell lines and fibroblasts B. Table S2. Real time PCR primers. Figure S1. mRNA expression levels of the four 4SC-202 targets. Fig. S2. 4SC-202 induces G2/M arrest in cell lines from different cancer entities. Figure S3. The G2/M arrest induced by different concentrations of 4SC-202 inversely correlates with the level of histone modifications. Figure S4. Concentration dependent induction of histone modifications by 4SC-202. Figure S5. G2/M arrest and cell death induced by 4SC-202 and FK228 concentrations applied in the NanoString experiment (Fig. 4a and b). Figure S6. Inhibition of gene transcription by 1 μg/ml actinomycin D. Figure S7. Active gene transcription is not required for a 4SC-202-mediated G2/M arrest. Figure S8. HDAC1/HDAC3 double knockdown does not lead to induction of a G2/M arrest. Figure S9. 4SC-202 induces cell death preceded by a G2/M arrest in HeLa cells. Figure S10. LSD1 knockdown or knockout does not affect cell death induced by 4SC-202. Figure S11. Enforced expression of HDAC1 counteracts FK228 but not 4SC-202. Figure S12. 4SC-202 reduces the fraction of intracellular polymeric tubulin and activates the spindle assembly checkpoint. (PDF 2399 kb)
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Wobser, M., Weber, A., Glunz, A. et al. Elucidating the mechanism of action of domatinostat (4SC-202) in cutaneous T cell lymphoma cells. J Hematol Oncol 12, 30 (2019). https://doi.org/10.1186/s13045-019-0719-4
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s13045-019-0719-4