Introduction

Low back pain (LBP) is a common orthopedic disease over the world and has become the greatest cause of disability globally [12], resulting in huge financial and social burdens [13]. About 540 million patients are given the diagnostic code reflective of spinal osteoarthritis. LBP is defined as pain and discomfort located to lumbar region and/or gluteal region, anatomically from the 12th thoracic vertebra to the gluteal sulcus with or without radiating pain [14]. In most cases, it is difficult to identify the specific structural cause of pain [15]. At present, surgery has not have a satisfactory long-term effect despite the main clinical treatment for IDD. Based on this, many studies turn to non-invasive alternatives for IDD [16]. More and more Chinese medicines have been dug that they have an amazing treatment on IDD [17,18,19,20]. Shensuitongzhi formula (SSTZF) is a drug commonly used in clinical treatment for orthopedic diseases such as fracture [1, 2]. Briefly, pentobarbital sodium-anesthetized mice were positioned prone, and the supraspinous ligament, interspinous ligament and spinous process between their second lumbar and sixth lumbar vertebrae were freed, and then, the supraspinous ligament, interspinous ligament and spinous process between the third and fifth lumbar vertebrae were clipped with curved scissors. Meanwhile, only the paravertebral muscle tissue was removed from the mice in the sham group. Finally, the incision was sutured and antibiotics were administered to prevent infection and put back into the mouse cage.

Micro-CT(μCT) analysis

Spinal tissues were collected from the thirteenth thoracic vertebra to the first sacral vertebra of mice after 4 weeks and 8 weeks postoperatively, and the muscle tissues around the spine were stripped clean and then fixed in 4% cellular tissue fixative for three days. The fixed end tissue samples were placed in the micro-CT mouse bed in the sagittal direction for X-ray scanning. After scanning, 3D reconstruction and 3D image creation were performed using on-board NRecon reconstruction software and CTvox graphics software to observe the lumbar disc tissue gap size and endplate ossification formation. Finally, the region of interest (ROI) was quantitatively analyzed using the airborne bone micromorphometric analysis software CTAn [1].

Histomorphological staining

After rinsing the residual fixative from the surface with running water at the end of fixation, the samples were submerged in 14% EDTA solution for 14 days for decalcification. Then, the surface decalcification solution was rinsed under running water and placed in gradient alcohol for dehydration and subsequent paraffin embedding. Paraffin tissues were stained in sections of 3 μm thickness. After the sections were dewaxed and rehydrated, the lumbar disc tissues were morphologically observed with Alcian blue/hematoxylin and orange G staining (ABH staining). Based on the results of ABH staining and the histological assessment scale for lumbar disc tissue, data were evaluated for each histological variable in the disc structure and cartilage endplate structure, respectively [3].

Tartrate-resistant acid phosphatase (TRAP) staining

Tissue sections from each experimental group were stained by tartrate-resistant acid phosphatase (TRAP) to detect the activity of osteoclasts in the endplate of the lumbar disc cartilage in mice and to quantify the number of osteoclasts (N.Oc/TA) as previously described. Briefly, anhydrous sodium acetate, sodium tartrate and glacial acetic acid were prepared into a 200-mL base working solution and preheated at 37 °C. The slices were dewaxed and rehydrated into the base working solution with naphthol AS-BI phosphate and baked at 37 °C for 1 h. Then, transfer to another base working solution mixed with sodium nitrite and basic magenta and incubate for 5–10 min; the color appears to terminate the staining. Finally, alcohol-free hematoxylin staining was used as the background color.

Immunohistochemical staining

For immunohistochemical (IHC) assays, the sections were treated with 0.01 M citrate buffer (Solarbio, Bei**g, China) for 4 h at 60 °C as antigen repair after dewaxing and rehydration was completed. Next, the sections were incubated in Col2, Mmp13, IL-1β, TNF-α and p-P65 primary antibodies overnight at 4 °C. The next day after incubation with the cognate secondary antibody for 20 min, diaminobenzidine (DAB) solution was applied to detect positive staining, while hematoxylin was applied for counterstaining. Positive staining was assessed semi-quantitatively using Image-Pro Plus software (Media Cybernetics, Silver Spring, USA).

Cell culture

Primary chondrocytes were obtained from two-week-old C57BL/6 J mice. The mice were executed and sterilized by immersion in 75% alcohol, and lumbar endplate cartilage was isolated aseptically. Then, phosphate buffer was washed three times and digested with 0.25% collagenase dissolved in F12/ DMEM medium in a cell culture incubator overnight. The following day, the digested primary chondrocytes were cultured in DMEM/F12 medium containing 10% FBS and 1% streptomycin/penicillin and incubated in an incubator at 37 °C and 5% CO2 for subsequent experiments.

Real-time quantitative PCR assay

Lumbar vertebral bone tissue stored in − 80 °C refrigerator was ground into powder form with liquid nitrogen, and then, a portion was added to 1 mL of Trizol solution. The primary chondrocytes cultured in vitro were added to 500μLTrizol solution. Bone tissue RNA was extracted and reverse transcribed according to the operating instructions of RNeasy Mini Kit (QIAGEN) and All-in-One cDNA Synthesis SuperMix (Bimake). The qPCR assay was then performed with 2 × SYBR Green qPCR Master Mix (Low ROX) (Bimake) reagent. And β-actin was used as a control gene for quantitative analysis. The target gene primer sequences were as follows:

Primer name

Primer sequences (5’ → 3’)

IL-1β Forward

GCAACTGTTCCTGAACTCAACT

IL-1β Reverse

ATCTTTTGGGGTCCGTCAACT

TNFα Forward

CCCTCACACTCAGATCATCTTCT

TNFα Reverse

GCTACGACGTGGGCTACAG

Mmp13 Forward

TTTGAGAACACGGGGAAGA

Mmp13 Reverse

ACTTTGTTGCCAATTCCAGG

Col2 Forward

TGGTCCTCT GGGCATCTCAGGC

Col2 Reverse

GGTGAACCTGCTGTTGCCCTCA

RELA Forward

AGGCTTCTGGGCCTTATGTG

RELA Reverse

TGCTTCTCTCGCCAGGAATAC

β-actin Forward

GGAGATTACTGCCCTGGCTCCTA

β-actin Reverse

GACTCATCGTACTCCTGCTTGCTG

Western Blot assay

Another portion of the above ground powdered bone tissue and in vitro cultured primary chondrocytes were added to the appropriate amount of RIPA lysis solution (containing protease inhibitor, ready to use) and lysed by repeated shaking on ice for 30 min. Then, place in a centrifuge at 4 °C for 10 min at 12,000 rpm and aspirate the supernatant into a new 1.5-mL centrifuge tube. The protein concentration of each group was first measured by the BCA protein quantification kit, and then, a certain volume of 5 × loading buffer was added to the remaining protein supernatant (so that the final concentration was 1 ×), and finally denatured by boiling at 100 ℃ for 5 min. Next, proteins were separated on 8% SDS–PAGE gels (20 μg/lane) and transferred to NC membranes. After incubation with 5% skim milk for 1 h, the primary antibodies were incubated with Col2 (1:1000 dilution, Abcam), Mmp13 (1:1000 dilution, Huaan), p65 (1:1000 dilution, Cell Signaling Technology), p-P65 (1:1000 dilution, Cell Signaling Technology) and β-actin (1:10,000 dilution, Sigma-Aldrich) for 16 h at 4 °C. After that, the protein bands were visualized by incubation with the corresponding cognate secondary antibodies for 1 h at room temperature and finally with Image Quant LAS 4000 (EG, USA). Using β-actin as an internal reference, the grayscale values of the protein bands were calculated using ImageJ software to analyze the expression of the target protein between groups.

Statistical analysis

All experimental data in this subject were statistically analyzed using SPSS 25.0 software, and the statistical results of the measures were expressed as mean ± standard deviation. One-way analysis of variance (one-way ANOVA) was used for comparison between different groups, and if the variance was not equal, Dunnett's T3 test was used. The difference was statistically significant at P < 0.05.

Results

SSTZF attenuates cartilage endplate calcification and delays disc degeneration

Narrowing the IVD space is one of the typical features of disc degeneration, so we first focus on the spatial variation in the lumbar interstitial space. Midsagittal scanning images indicated that the LSI operation narrowed disc height which between L4 and L5. However, the descending height could be partly rescued by SSTZF (Fig. 1A). In addition, the results of the three-dimensional (3D) reconstruction of disc and cartilage endplates in SSTZF are as same as the trend of intervertebral space size change (Fig. 1B). Also, the 3D reconstructions show that the cavity in the region of endplate ossification is the main cause of the reduction in disc volume, whereas the cartilage endplates are relatively intact in the sham-operated group mice.

Fig. 1
figure 1

SSTZF attenuates disc degeneration in LSI-operated mice. A 2D image of the median sagittal view of L4-5 lumbar spine; the red shear head indicates the L4-5 intervertebral space; B 3D image of the cartilage endplate ossification layer of L4-5 lumbar spine; the red arrows indicate the ossification layer cavity structure; C, D the bone volume of the lower cartilage endplate ossification layer of L4 lumbar spine and the upper cartilage endplate ossification layer of L5 lumbar spine after 4 weeks of modeling; E, F the bone volume of the lower cartilage endplate ossification layer of L4 lumbar spine and the upper cartilage endplate ossification layer of L5 lumbar spine after 8 weeks of modeling, respectively. Data were presented as means ± S.D.*P < 0.05; **P < 0.01; ***P < 0.001; ns: no significant difference. n = 6 for each group

Full size image

Importantly, the bone volume in the region of endplate ossification was significantly reduced in mice at week 4 of SSTZF treatment compared with the model group especially in the L4 IVD (Fig. 1C and D). However, the bone volume in the endplate ossification region was reduced at week 8 of SSTZF treatment; there was no statistical difference compared with the model group (Fig. 1E and F). These data suggest that SSTZF can delay the degeneration of IDD in LSI mice.

SSTZF protects against LSI-induced degeneration of cartilage endplates and intervertebral discs in mice

As the radiological results already suggest that SSTZF could inhibit cartilage endplate ossification in LSI mice, ABH staining was used to assess the degeneration of the intervertebral discs in LSI mice.

Compared with the sham group, the NP region of the intervertebral disc in the LSI group is significantly extruded and deformed severe volume reduction. The CEP region has formed obvious ossification centers with thickened ossification layers and obvious cavity structures which were gradually worsened with age (Fig. 2A).

Fig. 2
figure 2

SSTZF attenuates cartilage endplate calcification in LSI mice. A ABH staining of the entire L4/5 intervertebral disc. B Histological variables scored in the disc region and cartilage endplate region in the lumbar spine of 4W mice after LSI surgery. C Histological variables scored in the disc region and cartilage endplate region in the lumbar spine of 8W mice after LSI surgery. IVD: disc region, CEP: cartilage endplate region. Data were presented as means ± S.D.*P < 0.05; **P < 0.01; ***P < 0.001; ns: no significant difference. n = 6 for each group

Full size image

Interestingly, SSTZF mice showed that the structure of NP was still relatively intact at 4 weeks and it arises a situation that little chondrocytes in CEP region showed hypertrophic differentiation. As well, the cartilage endplates were significantly delayed calcification at 8 weeks (Fig. 2A). These data suggest that SSTZF can improve the progression of LSI-induced IDD. In addition, disc and cartilage endplate scores are significantly lower in the SSTZF group than in the model group at both 4 and 8 weeks (Fig. 2B and C). Because the appearance of cavities in ossified areas of the cartilage endplates may cause by the increasing osteoclasts activity, we observed the degree of osteoclasts activity in mice by Trap staining. The results showed that osteoclasts are mostly active in the cartilage endplate region in model group during the process of IDD, especially in the cavity after cartilage endplate ossification. However, SSTZF treatment significantly inhibits osteoclasts secreting TRAP in cartilage endplate in mice (Fig. 3A–D). These above histopathological data suggest that SSTZF effectively protects against LSI-induced degeneration of cartilage endplates and intervertebral discs.

Fig. 3
figure 3

SSTZF attenuates osteoclast activity in the intervertebral discs of LSI mice. A, B Proportion of TRAP-stained and positive cells in the endplate of the disc cartilage of the lumbar spine of LSI-operated 4W mice. Red arrows indicate positive cells. C, D Proportion of TRAP staining and positive cells in the endplate of intervertebral disc cartilage in the lumbar spine of LSI-operated 8W mice. Red arrows indicate positive cells. Data were presented as means ± S.D.*P < 0.05; **P < 0.01; ***P < 0.001; ns: no significant difference. n > 3 for each group

Full size image

SSTZF delays LSI surgery-induced degradation of cartilage matrix

The ECM is an important tissue structure of intervertebral disc which can withstand pressure. The CEP, as an important structural component of the disc, not only relieves the axial pressure on the NP, but also serves as a pathway for nutrient delivery to the internal tissues of the disc. First, the mRNA levels of anabolic/catabolic genes (Col2 and Mmp13) were detected in lumbar vertebral tissues of each group of mice by qRT-PCR. Compared with LSI group, Col2 expression was significantly increased in SSTZF group, while Mmp13 expression was greatly reduced (Fig. 4A and B). Then, the spatial expression was further examined by IHC which showed that Col2 expression was significantly reduced and Mmp13 expression was significantly increased in the intervertebral disc tissue in the model group (Fig. 4C–F). In contrast, SSTZF can significantly inhibit the downregulation of Col2 expression and elevation of Mmp13 expression in the intervertebral disc tissues of mice (Fig. 4C–F). These data suggest that SSTZF inhibits the degradation of cartilage matrix to delay IDD.

Fig. 4
figure 4

Effect of SSTZF on the anabolic and catabolic metabolism of cartilage endplates after LSI surgery. A, B Expression levels of Col2 and Mmp13 genes in bone tissue of mouse lumbar spine; C, D immunohistochemical staining and quantification of Col2 in the cartilage endplates of the intervertebral discs of mice with 8W LSI surgery; E, F immunohistochemical staining and percentage of positive cells of Mmp13 in the cartilage endplates of the intervertebral discs of mice with 8W LSI surgery. Red arrows indicate positive cells. Data were presented as means ± S.D.*P < 0.05; **P < 0.01; ***P < 0.001; ns: no significant difference. n > 3 for each group

Full size image

SSTZF inhibits LSI-induced inflammatory factor expression

The involvement of inflammatory cytokines is one of the main factors leading to the degenerative disc changes as well as the imbalance of disc metabolism. The qRT-PCR analysis of lumbar spine bone tissue revealed that the mRNA expression of inflammatory factor genes such as IL-1β and TNF-α was significantly elevated in the lumbar spine of mice in the model group. However, SSTZF group was able to significantly reduce the expression of IL-1β and TNF-α (Fig. 5A and B). Then, we further examined their expression by IHC. Compared with the sham group, the results in the model group mice showed that a large number of TNF-α and IL-1β positive staining areas appeared in the cartilage endplate region of the lumbar discs, especially in the cartilage endplate cavity structure (Fig. 5C–F). However, SSTZF significantly inhibited the secretion of inflammatory factors (Fig. 5C–F). The above data suggest that SSTZF delays calcification and degeneration of the cartilage endplates by inhibiting the expression of inflammatory factors in LSI surgery-induced.

Fig. 5
figure 5

Effect of SSTZF on inflammatory factors in cartilage endplates after LSI surgery. A, B Expression levels of TNF-α and IL-1β genes in bone tissue of lumbar spine of mice; C, D immunohistochemistry of TNF-α and IL-1β in cartilage endplates of intervertebral discs of lumbar spine of mice with 8W LSI surgery. Red arrows indicate positive cells; E, F quantitative analysis of TNF-α and IL-1β positive cell rates. Data were presented as means ± S.D.*P < 0.05; **P < 0.01; ***P < 0.001; ns: no significant difference. n > 3 for each group

Full size image

SSTZF inhibits the activation of NF-κB signaling pathway in CEP to delay IDD

Studies have shown that IL-1β and TNF-α (two inflammatory cytokines) closely associate with IDD as well as closely link to the NF-κB signaling pathway [4,5,6,7,8,9,10,11]. However, whether SSTZF inhibits NF-κB signaling in cartilage endplates has not been clarified. First, qRT-PCR analysis of lumbar vertebral bone tissue revealed that the expression level of RELA, a key regulatory gene of NF-κB signaling, was significantly inhibited by SSTZF compared with the model group (Fig. 6A). Then, we detected the expression of p-p65, a key regulatory protein of NF-κB signaling pathway, in lumbar vertebral bone tissue by WB. As expected, SSTZF group significantly inhibited p-p65 protein expression in lumbar vertebral bone tissue of LSI group (Fig. 6B and C). Similarly, the SSTZF significantly inhibited p-p65 protein positive staining cells in the cartilage endplate region compared to the model group (Fig. 6D and E). These data suggest that SSTZF delaying IDD process is closely associated with the inhibition of NF-κB signaling pathway.

Fig. 6
figure 6

Effect of SSTZF on NF-κB signaling in cartilage endplates after LSI surgery. A Expression level of RELA gene in bone tissue of mouse lumbar spine; B, C protein expression level and quantitative analysis of p-p65 in bone tissue of mouse lumbar spine; D, E immunohistochemistry and quantitative analysis of positive cell rate of p-p65 in cartilage endplates of intervertebral discs of lumbar spine in mice with 8W LSI surgery. Data were presented as means ± S.D.*P < 0.05; **P < 0.01; ***P < 0.001; ns: no significant difference. n > 3 for each group

Full size image

SSTZF abrogates TNF-α treatment-induced activation of NF-κB signaling pathway, catabolism and inflammation in chondrocytes in vitro

The above data suggest that SSTZF can alleviate the degeneration of chondrocytes in endplate in vivo. Therefore, we used primary chondrocytes to investigate the effect of SSTZF on TNF-α-treated cells in vitro. First, a qRT-PCR assay showed that SSTZF significantly decreased the mRNA expression of Mmp13, IL-1β and TNF-α but increased the expression of Col2, which was consistent with the trend of IHC results in vivo (Fig. 7A–D). Then, WB was used to determine the changes of the expression levels of Col2, Mmp13 and p-p65 which is the key factor of NF-κB signaling pathway. The data showed that the protein expression levels of Mmp13 and p-p65 were significantly increased in TNF-α-treated chondrocytes, while the expression level of Col2 was significantly decreased. However, SSTZF-containing serum was able to inhibit the expression of Mmp13 and p-p65 and promote the expression of Col2 (Fig. 7E–G). These data partially confirm that SSTZF can protect chondrocytes from catabolic and inflammatory effects by inhibiting the activation of NF-κB signaling pathway.

Fig. 7
figure 7

Effect of SSTZF on TNF-α-induced primary chondrocytes in vitro. A–D Gene expression of TNF-α-induced primary chondrocytes treated with SSTZF-containing serum for 24 h. E–G Protein expression of TNF-α-induced primary chondrocytes treated with SSTZF-containing serum for 24 h. Data were presented as means ± S.D.*P < 0.05; **P < 0.01; ***P < 0.001; ns: no significant difference. n = 3 for each group

Full size image

Discussion

For the first time, we proof the effect of SSTZF on the progression of IDD in animal models and explore its mechanism preliminarily. Histological and μCT results showed that SSTZF effectively delayed the degradation of cartilage matrix, inhibited the expression of LSI-induced inflammatory factors and protected the cartilaginous endplate calcification and intervertebral disc degeneration of LSI-induced mice. SSTZF was also demonstrated to delay IDD progression by inhibiting NF-κB signaling pathway in vivo and in vitro. These data provides a new and reliable evidence for the clinical treatment of LBP by SSTZF.

SSTZF, a traditional Chinese Herbal formula, has many function on different disease not only orthopedic disease but also internal disease [43].Our previous study had demonstrated that SSTZF may decelerate osteoarthritic cartilage degeneration [44] via reducing the expressional level of MMP13 in cartilage of DMM-induced mice [45]. In addition, it was been reported that had an effective treatment on fracture [21]. The recent results showed that SSTZF modulates NP cell proliferation and ECM remodeling in IDD [30]. As the same results as we has, in our experiment, SSTZF has the also function on IDD through restoring the metabolic balance of ECM. In this study, we used the LSI mouse model to simulate the human IDD process. μCT and ABH staining results were similar to those previously reported [46]. Reduced disc height, vertebral endplate sclerosis and decreased IVD volume were observed in LSI mice. However, mice treated with SSTZF showed the opposite result to the model group at 4 and 8 weeks after LSI surgery, suggesting that SSTZF delays disc degeneration and IDD progression by reducing cartilaginous endplate calcification.

Recent studies have shown that cartilage endplate degeneration is also a key factor in the pathogenesis of IDD [47]. The CEP is a thin layer of hyaluronic cartilage that acts as a semi-permeable barrier which not only delivers nutrients but also be a cushion for mechanical load [33]. In the IDD process, the balance between ECM anabolism which mainly include col2 and catabolism which mainly include Mmp13 is broken [11]. In intervertebral disc degeneration, Mmp13 expression quantity significantly increases in IDD as well as in arthritis [20]. As a result, Col2 expression quantity decreased and Mmp13 expression quantity increased in LSI group. The expression of Col2 and Mmp13 in the SSTZF group was significantly increased compared with LSI group. Therefore, SSTZF can maintain the normal integrity of cartilage endplate by restoring the metabolic balance of ECM, delaying the calcification and degeneration of the endplate.

During the IDD process, a large number of inflammatory factors, such as TNF-α and IL-1β, are produced in ECM. These cytokines promote matrix degradation, chemokines production and cell phenotypic change [48], leading to the dysmetabolism of ECM. In the previous report, inflammatory cytokines are closely related to NF-κB signaling pathway [49]. Also, it has been demonstrated that NF-κB is involved in IDD by regulating ECM degradation, oxidative stress, aging and cell death [31]. NF-κB exists as a dimer which is a member of the Rel protein family. Common Rel proteins are Rel A (p65), RelB, c-­Rel, p50 and p52 [50]. Rel A (p65) is one of the most widespread proteins in eukaryotic cells and has the most vital regulatory roles [51]. Also, phosphorylation and nuclear translocation of P65 are the classical activation of the NF-κB [52]. Therefore, the expression of p-P65 was detected. Compared with the model group, the expression of p-P65 in the SSTZF group was significantly reduced. These results suggest that SSTZF may delay IDD progression by inhibiting the activation of NF-κB. Previous studies have shown that SSTZF has a wide range of favorable therapeutic effects on orthopedic diseases, many of which are achieved through anti-inflammatory and regulation of internal stromal metabolic status. This is the first time that our results demonstrated that SSTZF can reduce inflammatory response and regulates stromal homeostasis in the treatment of IDD through inhibiting the activation of NF-κB.

However, the shortcoming of our present study is that we have not detected the molecular pharmacological mechanism of the active SSTZF. Investigating the possible biological processes of SSTZF may be beneficial for further research and help us using the SSTZF more effectively.

Conclusions

In our study, the degeneration of LSI-induced mice’s tissue phenotype can be salvaged by SSTZF. The function of these, on the one hand, is that SSTZF can inhibit the ECM degradation pathway of intervertebral disc tissue and, on the other hand, is that SSTZF can inhibit the activation of NF-κB. Our results suggested that SSTZF can be used in the clinical as an alternative therapy for IDD.