Background

Brucella is a Gram negative facultative intracellular bacterium that can cause brucellosis or Malta Fever, the world's most widespread zoonotic disease [1]. In humans Brucella causes an undulant fever that can be accompanied by complications such as endocarditis, arthritis and osteomyelitis [2]. Brucella is a stealth pathogen, known for its silent entry into host cells and multiple mechanisms to suppress host innate immune signalling, including non-toxic lipid A, and avoidance of oxidative burst and Toll like receptor (TLR) signalling cascades [2]-[6]. Whereas the primary task of immune cells is to phagocytose and degrade microbes, many intracellular pathogens, including Brucella, use secretion systems to introduce bacterial effector proteins directly into host cells to alter host cell biology and favour their intracellular replication [7],[8]. For full virulence, Brucella requires its VirB type IV secretion system (T4SS) to modulate endosomal trafficking, and create a replication niche in ER-derived membrane vesicles, named Brucella containing vacuoles (BCV) [9]-[11]. For many years, the effector proteins translocated by the Brucella VirB system remained elusive. After the identification of a first candidate [12], recent efforts from several laboratories, using both bioinformatics screens and translocation assays have resulted in a list of possible effectors [13]-[16]. To date, the precise role of most of these proteins in Brucella virulence is still not clear and the subject of intense research.

Recently, the proteins BtpA (Btp1/TcpB) and BtpB have been shown to be translocated by Brucella into host cells [17]. Although a TEM-1 β-lactamase assay did not show a significant difference in translocation efficiency of the proteins from wild type and virB mutant bacteria, a CyA reporter assay showed VirB-dependent protein transport into host cells, suggesting BtpA and BtpB may be substrates of the VirB T4SS. BtpA and BtpB belong to a class of bacterial proteins first described in Salmonella, Escherichia coli and Brucella that share homology with the eukaryotic Toll/Interleukin-1 receptor (TIR) domain [18],[19]. A conserved TIR domain is present in eukaryotic TLR proteins as well as their downstream signalling TIR adaptor proteins, including the central cytosolic adapter protein MyD88. The TIR domain is essential for TLR and adaptor interactions and for the onset of a signalling cascade resulting in nuclear translocation of the transcription factor NFκB, followed by the production of pro-inflammatory cytokines and type I interferons [20]. TIR domain interactions play a key role in activating conserved cellular signal transduction pathways in response to pathogen signals, and it was suggested that bacterial TIR proteins interfere with host TLR defence signalling by molecular mimicry (reviewed in [21]).

B. abortus 2308 BtpA (BAB1_0279) and the almost identical B. melitensis 16M BtpA (BMEI1674) down modulate maturation of dendritic cells [22] and inhibit TLR-induced NFκB activation. It has been suggested that this is through interference with the TLR4/MyD88/TIRAP complex [23]-[27], however the exact binding partner of BtpA is still a subject of controversy. Far less is known about BtpB, however recently it has also been shown to play a role in immune modulation [17]. Recently we, and others, published the crystal structure of the BtpA TIR domain, which showed a dimeric arrangement of a canonical TIR domain [25],[28],[

Materials and methods

Bacterial strains

For cloning Escherichia coli DH5α was cultured at 37°C in Luria-Bertani broth (LB) (Invitrogen, Merck). Kanamycin (25 μg/ml) or chloramphenicol (30 μg/ml) were added to the media when appropriate.

Plasmids and site-directed mutagenesis

A 828 bp version of the btpA gene was cloned from B. melitensis 16M genomic DNA (BMEI1674, Genbank accession NP_540591 is the shorter annotated version) using PCR (primers Bgl II L1674-F 5'-GAAGATCT TATGAGTTCGTACTCTTCTAATATTG-3', and Pst IL1674-R 5'-AACTGCAG TCAGATAAGGGAATGCAGTTC-3') and cloned in frame with the GFP coding sequence in eukaryotic expression plasmid pEGFP (Clontech) using standard protocols, resulting in plasmid pIN271.

A 978 version of the btpB gene was cloned from B. suis genomic DNA (BR0735, Genbank accession number AAN29664 is the shorter annotated version) using PCR (primers Bgl II 735-F 5'-GAAGATCT TATGACATCTAGTCGCGACACG-3', and Pst I 735-R 5'-AACTGCAG CTAGGTGATGAGGGCGACG-3') and cloned in frame with the GFP coding sequence in pEGFP resulting in plasmid pIN292. We amplified a longer version of btpB, which was recently also shown to complement a B. abortus btpB mutant in the control of NF-κB translocation into the nucleus [17].

Site directed mutagenesis of the WxxxE motif was done using the QuickChange Site-Directed Mutagenesis kit (Stratagene) following manufacturer's instructions, using pIN271 as a template with the following mutagenic primers for btpA (changed codons for Trp (TGG) and Glu (GAA) are italicised): W213A (5'-TTTAGCAAGCAAGCG CCCGCAAGAGAATTAG-3'), W213S (5'-TTTAGCAAGCAATCG CCCGCAAGAGAATTAG-3'), W213F (5'-TTTAGCAAGCAATTC CCCGCAAGAGAATTAG-3'), E217A (5'-CAATGGCCCGCAAGAGCA TTAGATGGACTGAC-3'), E217D (5'- CAATGGCCCGCAAGAGAT TTAGATGGACTGAC-3'), I226S (5'- CTGACGGCAATGGAAAGT GGCGGACAGACGC-3'), G183A (5'- CATATACGTTGAAGGTCGCT GACAGCCTTCGGCG-3'), and btpB (pIN292 as a template): W263S (5'- CTATCAGCGAAAAGACTCG TGCGGCGTCG-3') and E267A (5'- CTGGTGCGGCGTCGCG TTCCGCGCGATTCG-3'). Constructs were verified by DNA sequencing (Eurofins MWG operon, Germany). Table 2 summarizes the plasmids used in this study.

Table 2 Strains and plasmids used in this study
Full size table

Cell culture, transfection, immunocytochemistry, and fluorescence microscopy

HeLa cells were grown in RPMI 1640 (Gibco) supplemented with heat-inactivated 10% fetal bovine serum (FBS, Lonza, Switzerland). Transfections were performed using Lipofectamine 2000 (Invitrogen). For immuno fluorescence studies, cells were seeded on coverslips (BD Bioscience) and cultured overnight in 12-well dishes. Cells were transfected and, after 16–20 hours, treated with nocodazole (Sigma M1404) at a concentration of 1 μg/ml for 30 min if desired. Cells were fixed with 4% PFA, and processed for immunocytochemistry. Monoclonal mouse anti-β-tubulin (Sigma Aldrich, T4026), mouse anti-FK2 (Enzo Life science, BML-PW8810), Texas Red anti-mouse (Vector Laboratories, TI-2000), Rhodamin phalloidin (Invitrogen R415), Rabbit anti-BtpA (a gift from Marty Roop, East Carolina University, Greenville), FITC anti-rabbit (Vector Laboratories, FI-2000) were used for immune labelling. Immuno fluorescence microscopy was performed using a LEICA DM/IRB microscope using filter sets L5 (band pass (BP) 480/40; Beam splitter (BS) 505; emission BP527/30) and N2.1 (515–560; BS 580; emission long pass (LP) 590), respectively. For imaging we used a Coolsnap fx (Roper Scientifique) and MetaVue software, and images were further processed using Adobe Photoshop. Confocal analysis was performed at the RIO imaging platform in Montpellier, with a Biorad MRC1024 confocal microscope.

Bio informatic analysis

Brucella genomes were obtained and compared on the PATRIC website [33]. Sequence alignments were performed using T-Coffee analysis, and further analysed using Jalview. Structural figures were generated with Pymol (www.pymol.org).

Additional files